Galk promoter

Details Galk promoter Galk promoter

2000-06-16

2001-09-18

McGarry, Sean (Department: 1635)

Chemistry: molecular biology and microbiology

Micro-organism, per se ; compositions thereof; proces of...

Bacteria or actinomycetales; media therefor

C435S006120, C435S320100, C435S325000, C435S253200, C435S243000, C536S023100, C536S024100

Reexamination Certificate

active

06291230

ABSTRACT:

FIELD OF THE INVENTION
This invention relates to newly identifed polynucleotides, and their production and uses, as well as their variants, agonists and antagonists, and their uses. In particular, the invention relates to promoter polynucleotides, as well as their variants, hereinafter referred to as “galK,” “galk promoter polynucleotide(s),” and “galK polynucleotide(s)” as the case may be.
BACKGROUND OF THE INVENTION
The Streptococci make up a medically important genera of microbes known to cause several types of disease in humans, including, for example, ottis media, conjunctivitis, pneumonia, bacteremia, meningitis, sinusitis, pleural empyema and endocarditis, and most particuarly meningitis, such as for example infection of cerebrospinal fluid. Since its isolation more than 100 years ago,
Streptococcus pneumoniae
has been one of the more intsively studied microbes. For example, much of our early understanding that DNA is, in fact the genetic material was predicated on the work of Griffith and of Avery, Macleod and McCarty using this microbe. Despite the vast amount of research with
S. pneuroniae
, many questions concerning the virulence of this microbe remain. It is particularly preferred to employ Streptococal genes and gene products as targets for the development of antibiotics.
The frequency of
Streptococcus pneumoniae
infections has risen dramatically in the past few decades. This has been attributed to the emergence of multiply antibiotic resistant strains and an increasing population of people with weakened immune Systems. It is no longer uncommon to isolate
Streptococcus pneumoniae
strains that are resistant to some or all of the standard antabiotics. This phenomenon has created an unmet medical need and demand for new anti-microbial agents, vaccines, drug screening methods, and diagnostic tests for this organism.
Moreover, the drug discovery process is currently undergoing a fundamental revolution as it embraces “functional genomics,” that is, high throughput genome- or gene-based biology. This approach is rapidly superseding earlier approaches based on “positional cloning” and other methods. Functional genomics relies heavily on the various tools of bioinformatics to identify gene sequences of potential interest from the many molecular biology databases now available as well as from other sources. There is a continuing and significant need to identify and characterize further genes and other polynucleotides sequences and their related polypeptides, as targets for drug discovery.
Clearly, there exists a need for polynucleotides, such as the galK polynucleotide embodiments of the invention, that have a present benefit of among other things, being useful to screen compounds for antimcrobial activity. Such factors are also useful to determine their role in gene regulation, pathogenesis of infection, dysfunction and disease. There is also a need for identification and characterization of such factors and their antagonists and agonists to find ways to prevent, ameliorate or correct such infection, dysfunction and disease.
SUMMARY OF THE INVENTION
The present invention relates to galK, in particular galK promoter polynucleotides, recombinant materials and methods for their production. In another aspect, the invention relates to methods for using such polynucleotides, including treatment of microbial diseases, amongst others. In a further aspect, the invention relates to methods for identifying agonists and antagonists using the materials provided by the invention, and for treating microbial infections and conditions associated with such infections with the identified agonist or antagonist compounds. In a still further aspect, the invention relates to diagnostic assays for detecting diseases associated with microbial infections and conditions associated with such infections, such as assays for detecting galK promoter driven expression or activity.
Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following descriptions and from reading the other parts of the present disclosure.
DESCRIPTION OF THE INVENTION
The invention relates to galK polynucleotides as described in greater detail below. In particular, the invention relates to polynucleotides of a galK of
Streptococcus pneumoniae
, which is related by sequence homology to no homolog polynucleotide or by the presence of characteristic motifs. The invention relates especially to galK promoter polynucleotides having the nucleotides sequences set out in Table 1. Note that sequences recited in the Sequence Listing below as “DNA” represent an exemplification of the invention, since those of ordinary skill will recognize that such sequences can be usefully employed in polynucleotides in general, including ribopolynucleotides.
TABLE 1
gaIK Polynucleotide Promoter Sequences
(A)
Streptococcus pneumoniae
galK polynucleotide sequence [SEQ ID NO:1].
5′-
CATAAATCCTCCTTGATTAGGTTAGTATATCATGTTTTTCTTCTTTTTACTGATATTTTACTAAAATTTTAG

TAAAAAGGATTGACCTTGGAAAATTCCTTGGATACAATAGAAAGAAAACGATTACACGTTAAGATGGCTTAA

CGGACAGTCAAAGGAGAATTCATATG-3′
Methods to identify promoters include techniques known in the art as well as those provided herein. Art techniques include, but are not limited to, the following.
RT-PCR
RT-PCR analysis of total RNA isolated from infected tissue or in vitro grown cells. Using genome databases, primer pairs are designed to predict transcripts of the selected pathogen and arrayed in microtiter dish format. Total RNA is isolated from an in vitro grown pathogen and RT-PCR performed with all the primer pairs. Similarly RT-PCR is performed with total RNA isolated at varying times from infections of the selected pathogen in a variety of appropriate animal models. Comparison of the PCR profiles which reflect the ratio of a given mRNA to internal standards such as rRNA or housekeeping genes provides identification of those transcripts which are essentially absent in vitro, but are on throughout, or during, various phases of infection.
Putative promoters are characterized using TaqMan quantitative RT-PCR, or expression of reporter genes.
Specific sequence detection occurs by amplification of target sequences in the PE Applied Biosystems 7700 Sequence Detection System in the presence of an oligonucleotide probe labeled at the 5′ and 3′ ends with a reporter and quencher fluorescent dye, respectively (TaqMan FQ probe), which anneals between the two PCR primers. Only specific product will be detected when the probe is bound between the primers. As PCR amplification proceeds, the 5′-nuclease activity of Taq polymerase initially cleaves the reporter dye from the probe. The signal generated when the reporter dye is physically separated from the quencher dye is measured with an attached CCD camera. Each signal generated equals one probe cleaved which corresponds to amplification of one target strand.
RT/PCR controls may include ± reverse transcriptase reactions, amplification along side genes known to be transcribed under the conditions of study and amplification of serial dilutions of genomic DNA. The level of transcription under in vivo and in vitro conditions is quantified by comparison of signal generated from these samples to that of a standard curve generated from signal resulting from amplification of the genomic DNA.
FAM and TAMRA labeling of primers and the uses of such primers has been reported. (Lee, LG, Connell, CR, and Bloch, W. 1993. Allelic discrimnation by nick-translation PCR with fluorogenic probes. Nucleic Acids Research 21:3761-3766; Livak, K J, Flood, S J A, Marmaro, J., Giusti, W, and Deetz, K. 1995. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods and Applications 4:357-362.)
And/or the promoter region can be cloned upstream of a reporter gene in a vector appropriate for the selected pathogen By “appropriate” it is meant a vector capable

Affiliated with

Also associated with

Rating

Galk promoter does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Galk promoter, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Galk promoter will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-2537680