Chemistry: molecular biology and microbiology – Micro-organism – tissue cell culture or enzyme using process... – Recombinant dna technique included in method of making a...
Reexamination Certificate
2000-10-02
2003-03-18
Spector, Lorraine (Department: 1647)
Chemistry: molecular biology and microbiology
Micro-organism, tissue cell culture or enzyme using process...
Recombinant dna technique included in method of making a...
C435S069100, C435S320100, C435S325000, C435S252300, C530S303000, C530S350000, C536S023510
Reexamination Certificate
active
06534288
ABSTRACT:
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to a synthetic derivative of the proinsulin C peptide. Proinsulin comprising this derivative has properties which are better in various ways than conventional monkey proinsulin, in particular the final yield of the particular insulin derivative is improved on recombinant preparation thereof.
2. Description of the Related Art
The number of patients with diabetes is continually increasing around the world. There is a proportionate increase in the demand for insulin or derivatives of insulin. Thus the object is to optimize the existing processes in relation to the yield of active ingredient. European patent EP-B1 0 489 780 proposes a process for preparing insulin or derivatives thereof. The vectors described therein are used to prepare human insulin with the plasmid pINT90d or else starting plasmids for constructing the plasmid pINT302d which is described in European patent application EP-A 0 821 006 and is used for preparing a His(B31) His(B32) Gly(A21)-insulin derivative, or to construct the vector pINT329d, which is described in European patent application EP-A 0 885 961 and is used for preparing the Lys(B3) Glu(B29)-insulin derivative.
SUMMARY OF THE INVENTION
The instant invention therefore provides a precursor of human insulin or a precursor of an insulin analog of the formula I:
Fus
-
B
(1-0)-
RDVP
-
Y
n
-
A
(1-21) (I);
wherein
Fus is an optionally present fusion portion;
B(1-30) is a B chain of human insulin,
Y is an amino acid chain which terminates with a basic amino acid at the C terminus;
n is from 2 to 50 and indicates the length of the amino acid chain Y; and
A(1-21) is an A chain of human insulin,
and the A chain and/or the B chain can be modified by amino acid substitutions, deletions and/or additions.
In one embodiment, Y
n
is amino acids 5 to 35 of a C peptide of human or monkey insulin.
In another embodiment, Y
n
is amino acids 11 to 35 of human insulin.
In another embodiment, the B chain of human insulin comprises: Lys(B3)Glu(B29).
In another embodiment, the B and A chains of human insulin comprise: His(B31)His(B32)Gly(A21).
The instant invention also provides DNA encoding for those precursors of the instant invention.
The instant invention also provides a vector comprising a DNA encoding for those precursors of the instant invention.
In one embodiment, the vector is an expression vector suitable for expression in a host cell, preferably
E. coli.
The instant invention also provides for a host cell comprising a vector comprising a DNA encoding for those precursors of the instant invention. Preferably the host is
E. coli.
The instant invention also provides for a process for preparing a precursor of the instant invention, comprising the steps of:
a) introducing a DNA coding for the instant precursors into a vector;
b) introducing the vector from (a) into a host cell;
c) allowing the host cell to express the precursor into a culture supernatant; and
d) isolating the precursor from the culture supernatant.
The instant invention also provides for a process for preparing DNA, comprising the steps of:
a) producing a DNA from a cDNA of human or monkey insulin by PCR; and
b) isolating said DNA;
wherein said DNA encodes a precursor of the instant invention.
The instant invention also provides for a process for preparing human insulin or an insulin analog, comprising the steps of:
a) preparing a said precursors by the instant processes of the instant invention;
b) forming disulfide bridges in the precursor by allowing the precursor from (a) to fold;
c) optionally enzymatically cleaving the fusion portion Fus; and
c) purifying the human insulin or the insulin analog.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
It has now been found that particularly advantageous proinsulin derivatives are those of the formula I,
Fus
-
B
(1-30)-
RDVP
-
Y
n
-
A
(1-21) (I);
wherein
Fus is an optionally present fusion portion of any suitable sequence;
B(1-30) is the B chain of human insulin,
Y is an amino acid chain which terminates with a basic amino acid at the C terminus;
n is from 2 to 50 and indicates the length of the amino acid chain Y; and
A(1-21) is the A chain of human insulin,
and wherein the A chain and/or the B chain can be modified by amino acid substitutions, deletions and/or additions. It is surprising in this connection that equal and mutually different advantages are observed depending on the composition of the insulin A or B chain.
Connection of the human B chain to the human A chain via the advantageous C peptide results in a proinsulin which behaves in terms of expression yield like wild-type proinsulin, but its enzymatic processing to insulin can be controlled more easily so that no disruptive traces of B chain extended by arginine are produced and have to be removed during preparation to give the pharmaceutical, causing losses of yield.
On connection of the B chain with a C-terminal di-histidine extension to the A chain of human insulin containing glycine in position A21 using the C peptide according to the invention there is found to be an expression yield which is about 20% higher than the yields which can be achieved with the plasmid pINT90d and a yield which is almost five times higher than observed with the plasmid pINT302d. In addition, control of the enzymatic processing is simplified in the same way as previously described.
On connection of a Lys(B3) Glu (B29)-modified B chain to the A chain of human insulin via the modified C peptide there is found to be improved folding properties of the proinsulin derivative compared with the proinsulin encoded by pINT329d. The yield of crude fusion protein is increased and reaches the same level as found with the plasmid pINT90d. In addition, control of the enzymatic processing is simplified.
A particularly advantageous embodiment of the novel C peptide is characterized by the following amino acid sequence: CGCGATGTTCCTCAGGTGGAGCTGGGCGGGGGCCCTGGCGCAGGCAGCCTGCAGCCCTTG RDVPQVELGGGPGAGSLQPL GCGCTGGAGGGGTCCCTGCAGAAGCGC (SEQ ID NO.: 1)
ALEGSLQKR (SEQ ID NO.: 2)
One of many possible DNA sequences coding for the indicated C peptide is likewise indicated.
One aspect of the invention is a precursor of human insulin or of an insulin analog of the formula I
Fus
-
B
(1-30)-
RDVP
-
Y
n
-
A
(1-21) (I);
wherein
Fus is an optionally present fusion portion of any suitable sequence;
B(1-30) is the B chain of human insulin,
Y is an amino acid chain which terminates with a basic amino acid at the C terminus;
n is from 2 to 50 and indicates the length of the amino acid chain Y; and
A(1-21) is the A chain of human insulin,
and wherein the A chain and/or the B chain can be modified by amino acid substitutions, deletions and/or additions, in particular where Y
n
is amino acids 5 to 35 of the C peptide of human or monkey insulin, preferably where Y
n
is amino acids 11 to 35 of human insulin.
Another aspect of the invention are precursors as described above, where the B chain of human insulin comprises the modifications Lys(B3) Glu(B29) or where the B and A chains of human insulin comprise the modifications His(B31) His(B32) Gly(A21).
The instant invention includes substitutions, additions, or deletions, of one or more amino acid residues of the claimed precursor of human insulin or precursor of an insulin analog of formula I.
Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and are designed to modulate one or more properties of the protein such as stability against proteolytic cleavage. Substitutions preferably are conservative, that is, one amino acid is replaced with one of similar shape and/or charge. Conservative substitutions are well known in the art and include, but are not limited to, the changes of: alanine to serine; arginine to lysine; asparigine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparigine; glutamate to aspartate; glycine to proline; histidine to asparigine or glutamine; isoleucine to
Ertl Johann
Habermann Paul
Meiwes Johannes
Seipke Gerhard
Aventis Pharma Deutschland GmbH
Heller Ehrman White & McAuliffe LLP
Lazar-Wesley Eliane
Spector Lorraine
LandOfFree
C peptide for improved preparation of insulin and insulin... does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with C peptide for improved preparation of insulin and insulin..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and C peptide for improved preparation of insulin and insulin... will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-3044690