Detection of human immunodeficiency virus type 1

Details Detection of human immunodeficiency virus type 1 Detection of human immunodeficiency virus type 1

2001-01-20

2003-11-18

Park, Hankyel T. (Department: 1648)

Organic compounds -- part of the class 532-570 series

Organic compounds

Carbohydrates or derivatives

C536S024330, C435S810000

Reexamination Certificate

active

06649749

ABSTRACT:

FIELD OF THE INVENTION
This invention relates to the design and construction of amplification oligonucleotides and probes to Human Immunodeficiency Virus Type 1 (HIV), which allow detection of the organism in a test sample.
BACKGROUND OF THE INVENTION
This section provides a brief outline of relevant areas. None of the art cited or referred to is admitted to be prior art to the claims. Laboratory diagnosis of Human Immunodeficiency Virus Type 1 in humans is currently performed by demonstration of the presence of viral antigen (p24) or anti-HIV-1 antibodies in serum. Direct detection of viral DNA, however, is a more useful diagnostic tool in some populations, such as infants born to seropositive mothers. Detection of viral DNA is more rapid and less hazardous than culture. Direct hybridization lacks adequate sensitivity in most patients (Shaw et al.
Science
226:1165-1171, 1984). Many references mention oligonucleotides said to have use in detection of Human Immunodeficiency Virus. Most of these references also mention the use of polymerase chain reaction (PCR). These references include the following: Kwok et al.,
J. Virol.
61: 1690-1694, 1987; Agius et al.,
J. Virol. Meth.,
30:141-150, 1990; Albert and Fenyo,
J. Clin. Microbiol.
28:1560-1564, 1990; Bell and Ratner,
AIDS Res. and Human Retroviruses
5:87-95, 1989; Bruisten et al.,
Vox Sane
61:24-29, 1991; Clarke et al.,
AIDS
4:1133-1136, 1990; Coutlee et al.,
Anal. Biochem.
181:96-105, 1989; Dahien et al.,
J. Clin. Microbiol.
29:798-804, 1991; Dudding et al.,
Biochem. Biophys. Res. Comm.
167:244-250, 1990; Ferrer-Le-Coeur et al.,
Thrombosis and Haemostasis
65:478-482, 1991; Goswami et al.,
AIDS
5:797-803, 1991; Grankvist et al.,
AIDS
5:575-578, 1991; Guatelli et al.,
J. Virol.
64:4093-4098, 1990; Hart et al.,
Lancet
2 (8611):596-599, 1988; Holland et al.,
Proc. Natl. Acad. Sci. USA,
88:7276-7278, 1991; Keller et al.,
Anal. Biochem.
177:27-32, 1989; Kumar et al.,
AIDS Res. and Human Retroviruses
5:345-354, 1989; Linz et al.,
J. Clin. Chem. Clin. Biochem.
28:5-13, 1990; Mano and Chermann,
Res. Virol.
142:95-104, 1991; Mariotti et al.,
AIDS
4:633-637, 1990; Mariotti et al.,
Transfusion
30:704-706, 1990; Meyerhans et al.,
Cell
58:901-910, 1989; Mousset et al.,
AIDS
4:1225-1230, 1990; Ou et al.,
Science
239:295-297, 1988; Pang et al.,
Nature
343:85-89, 1990; Paterlini et al.,
J. Med. Virol.
30:53-57, 1990; Perrin et al.,
Blood
76:641-645, 1990; Preston et al.,
J. Virol. Meth.
33:383-390, 1991; Pritchard and Stefano,
Ann. Biol. Clin.
48:492-497, 1990; Rudin et al.,
Eur. J. Clin. Microbiol. Infect. Dis.
10:146-156, 1991; Shoebndge et al.,
AIDS
5:221-224, 1991; Stevenson et al.,
J. Virol.
64:3792-3803, 1990; Truckenmiller et al.,
Res. Iimmunol.
140:527-544, 1989; Van de Perre, et al.,
New Eng. J. Med.
325:593-598, 1991; Varas et al.,
BioTechniques
11:384-391, 1991; Velpandi et al.,
J. Virol.
65:4847-4852, 1991; Williams et al.,
AIDS
4:393-398, 1990; Zacharet al.,
J. Virol Meth.
33:391-395, 1991; Zack et al.
Cell
61:213-222, 1990; Findlay et al., entitled “Nucleic acid test article and its use to detect a predetermined nucleic acid,” International Application No. PCT/US90/00452 and International Publication No. WO 90/08840; Gingeras et al., entitled “Nucleic acid probe assay methods and compositions,” International Application No. PCT/US87/01966 and International Publication No. WO 88/01302; Brakel and Spadoro, entitled “Amplification capture assay,” European Patent Application No. 90124738.7 and European Publication No. 0 435 150 A2; Moncany and Montagnier, entitled “Séquences nucléotidiques issues du génome des rétrovirus du typ hiv-1, hiv-2 et siv, et leurs applications notamment pour l'amplification des génomes de ces rétrovirus et pour le diagnostic in-vitro des infections dues á ces virus,” European Patent Application No. 90401520.3 and European Publication No. 0 403 333 A2; Urdea, entitled “DNA-dependent RNA polymerase transcripts as reporter molecules for signal amplification in nucleic acid hybridization assays,” International Application No. PCT/US91/00213 and International Publication No. WO 91/10746; Musso et al., entitled “Lanthanide chelate-tagged nucleic acid probes,” International Application No. PCT/US88/03735 and International Publication No. WO 89/04375; Chang, entitled “Cloning and expression of HTLV-III DNA,” European Patent Application No. 85307260.1 and European Publication No. 0 185 444 A2; and Levenson, entitled “Diagnostic kit and method using a solid phase capture means for detecting nucleic acids,” European Patent Application No. 89311862.0 and European Publication No. 0 370 694 A2; and Sninsky et al, U.S. Pat. No. 5,008,182.
SUMMARY OF THE INVENTION
This invention discloses novel amplification oligonucleotides and detection probes for the detection of Human Immunodeficiency Virus Type 1. The probes are capable of distinguishing between the Human Immunodeficiency Virus type 1 and its known closest phylogenetic neighbors. The amplification oligonucleotides and probes may be used in an assay for the detection and/or quantitation of Human Immunodeficiency Virus nucleic acid.
It is known that a nucleic acid sequence able to hybridize to a nucleic acid sequence sought to be detected (“target sequence”) can serve as a probe for the target sequence. The probe may be labelled with a detectable moiety such as a radioisotope, antigen or chemiluminescent moiety to facilitate detection of the target sequence. A background description of the use of nucleic acid hybridization as a procedure for the detection of particular nucleic acid sequences is provided in Kohne, U.S. Pat. No. 4,851,330, and Hogan et al., International Application No. PCT/US87/03009 and International Publication No. WO 88/03957, entitled “Nucleic Acid Probes for Detection and/or Quantitation of Non-Viral Organisms.”
It is also known that hybridization may occur between complementary nucleic acid strands including; DNA/DNA, DNA/RNA, and RNA/RNA. Two single strands of deoxyribo-(“DNA”) or ribo-(“RNA”) nucleic acid, formed from nucleotides (including the bases adenine (A), cytosine (C), thymidine (T), guanine (G), uracil (U), or inosine (I)), may hybridize to form a double-stranded structure in which the two strands are held together by hydrogen bonds between pairs of complementary bases. Generally, A is hydrogen bonded to T or U, while G is hydrogen bonded to C. At any point along the hybridized strands, therefore, one may find the classical base pairs AT or AU, TA or UA, GC, or CG. Thus, when a first single strand of nucleic acid contains sufficient contiguous complementary bases to a second, and those two strands are brought together under conditions which will promote their hybridization, double-stranded nucleic acid will result. Under appropriate conditions, DNA/DNA, RNA/DNA, or RNA/RNA hybrids may be formed. The present invention includes the use of probes or primers containing nucleotides differing in the sugar moiety, or otherwise chemically modified, which are able to hydrogen bond along the lines described above.
Thus, in a first aspect, the invention features hybridization assay probes able to distinguish Human Immunodeficiency Virus type 1 from other viruses found in human blood or tissues, and amplification oligonucleotides able to selectively amplify Human Immunodeficiency Virus nucleic acid. Specifically, the probes are nucleotide polymers which hybridize to the nucleic acid region of Human Immunodeficiency Virus type 1 corresponding to bases 763-793 of HIV type 1, (HXB2 isolate GenBank accession number K03455), or any of the regions corresponding to bases 1271-1301, 1358-1387, 1464-1489, 1501-1540, 1813-1845, 2969-2999, 3125-3161, 4148-4170, 4804-4832, 5950-5978, 9496-9523, 510-542, and 624-651; preferably, the oligonucleotide comprises, consists essentially of, or consists of the sequence (reading 5′ to 3′)
(SEQ ID
GACTAGCGGAGGCTAGAAGGAGAGAGATGGG
NO: 1)
(SEQ ID
GAAGGCTTTCAGCCCAGAAGTAATACCCATG
NO: 2)
(SEQ ID
ATTTGCATGGCTGCTTGATGTCCCCCCACT
NO: 3)

Affiliated with

Also associated with

Rating

Detection of human immunodeficiency virus type 1 does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Detection of human immunodeficiency virus type 1, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Detection of human immunodeficiency virus type 1 will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-3120876