Chemistry: molecular biology and microbiology – Measuring or testing process involving enzymes or... – Involving nucleic acid
Reexamination Certificate
1998-09-17
2002-08-13
Jones, W. Gary (Department: 1655)
Chemistry: molecular biology and microbiology
Measuring or testing process involving enzymes or...
Involving nucleic acid
C536S023100, C536S024300
Reexamination Certificate
active
06432640
ABSTRACT:
TECHNICAL FIELD OF THE INVENTION
This invention is related to genes and proteins involved in cell cycle control and tumorigenesis. These genes can be used diagnostically and therapeutically because of their role in cancers.
BACKGROUND OF THE INVENTION
The inactivation of the p53 gene in a large fraction of human cancers has inspired an intense search for the encoded protein's physiologic and biologic properties. Expression of p53 induces either a stable growth arrest or programmed cell death (apoptosis). In human colorectal cancers (CRC), the growth arrest is dependent on the transcriptional induction of p21WAF1/CIP1 (1), but the biochemical mechanisms underlying the development of p53-dependent apoptosis are largely unknown (2). Thus, there is a continuing need in the art for discovering new genes which are regulated by p53 and genes which are related to cell cycle control and tumorigenesis.
SUMMARY OF THE INVENTION
It is an object of the present invention to provide methods of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic.
It is another object of the present invention to provide an isolated and purified nucleic acid molecule which is identified by a SAGE tag.
It is an object of the present invention to provide an isolated nucleotide probe comprising at least 12 nucleotides of a rat nucleic acid molecule identified by a SAGE tag.
Another object of the invention is to provide methods and kits for evaluating cytotoxicity or carcinogenicity of an agent.
It is still another object of the invention to provide a DNA construct useful for screening drugs as anti-neoplastic agents.
It is even another object of the invention to provide a preparation of antibodies.
These and other objects of the invention are provided by one or more of the embodiments described below. One embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. The level of transcription of an RNA transcript in a first sample of a first tissue is compared to the level of transcription of the transcript in a second sample of a second tissue. The first tissue is suspected of being neoplastic and the second tissue is a normal human tissue. The first and second tissue are of the same tissue type. The transcript is identified by a tag selected from the group consisting of SEQ ID NOS:10, 15-22, 26, 27, and 30. The first sample is characterized as neoplastic or as having a mutant p53 when transcription is found to be the same or lower in the first sample than in the second sample.
Another embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. The level of transcription of an RNA transcript in a first sample of a first tissue is compared to the level of transcription of the transcript in a second sample of a second tissue. The first tissue is suspected of being neoplastic, and the second tissue is a normal human tissue. The first and second tissue are of the same tissue type. The transcript is identified by a tag selected from the group consisting of SEQ ID NOS:37-67. The first sample is categorized as neoplastic or as having a mutant p53 when transcription is found to be the same or higher in the first sample than in the second sample.
Yet another embodiment of the invention provides an isolated and purified nucleic acid molecule which comprises a SAGE tag selected from the group consisting of SEQ ID NOS:15, 16, 17, 19, 21, 22, and 30.
Even another embodiment of the invention provides an isolated nucleotide probe comprising at least 12 contiguous nucleotides of a human nucleic acid molecule. The human nucleic acid molecule comprises a SAGE tag selected from the group consisting of SEQ ID NOS:15, 16, 17, 19, 21, 22, and 30.
A further embodiment of the invention provides a kit for evaluating toxicity or carcinogenicity of an agent. The kit comprises at least 2 probes. The probes comprise at least 12 contiguous nucleotides of a human nucleic acid molecule. The human nucleic acid molecule comprises a SAGE tag selected from the group consisting of SEQ ID NOS:15, 16, 17, 19, 21, 22, and 30.
Another embodiment of the invention provides a kit for evaluating cytotoxicity or carcinogenicity. The kit comprises at least 2 probes. The probes comprise a SAGE tag selected from the group consisting of SEQ ID NOS:15, 16, 17, 19, 21, 22, and 30.
Even another embodiment of the invention provides a method for evaluating cytotoxicity or carcinogenicity of an agent. A test agent is contacted with a human cell. The level of transcription of a transcript in the human cell after contacting with the agent is determined. An agent which increases the level of a transcript identified by a SAGE tag selected from the group consisting of SEQ ID NOS: 10, 15-22, 26, 27, and 30, or an agent which decreases the level of a transcript identified by a SAGE tag selected from the group consisting of SEQ ID NOS:37-67 is a potential cytotoxin or carcinogen.
Another embodiment of the invention provides a method to determine the neoplastic status or p53 status of a cell. ROS levels in a first sample of a first tissue are compared to ROS levels in a second sample of a second tissue. The first tissue is or is suspected of being neoplastic, and the second tissue is a normal human tissue. Elevated levels of ROS in the first sample indicate expression of p53, and low levels of ROS in the first sample indicate lack of expression of p53. Lack of expression of p53 is an indicator of neoplasia.
Still another embodiment of the invention provides a DNA construct for screening drugs as anti-neoplastic agents. The DNA construct comprises a reporter gene under the control of a PIG-3 promoter. The reporter gene is 3′ and covalently linked to the PIG-3 promoter. The PIG-3 promoter comprises the sequence CAGCTTGCCCACCCATGCTC (SEQ ID NO:1).
A further embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. Cells of a test sample are treated with a DNA-damaging agent. The level of transcription of an RNA transcript in cells of the sample is compared to the level of transcription of the transcript in cells of the sample which are not subject to said treating. The transcript is identified by a tag selected from the group consisting of SEQ ID NOS:10, 15-22, 26, 27, and 30. The sample is characterized as neoplastic or as having a mutant p53 when transcription is found to be the same or lower in the treated cells than in the untreated cells.
Another embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. Cells of a test sample are treated with a DNA-damaging agent. The level of transcription of an RNA transcript in the cells is compared to the level of transcription of the transcript in cells of the sample which are not subject to said treating. The transcript is identified by a tag selected from the group consisting SEQ ID NOS:37-67. The sample is categorized as neoplastic or as having a mutant p53 when transcription is found to be the same or higher in the treated cells than in the untreated cells.
Even another embodiment of the invention provides a preparation of antibodies which specifically bind to a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:81, 83, 84, 86, 87, and 88.
Still another embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. The level of a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:79-88 and the amino acid sequence encoded by SEQ ID NO:72 in a first sample of a first tissue is compared to the level of the PIG protein in a second sample of a second tissue. The first tissue is suspected of being neoplastic, and the second tissue is a normal human tissue. The first and second tissue are of the same tissue type. The first sample is categorized
Kinzler Kenneth W.
Polyak Kornelia
Vogelstein Bert
Banner & Witcoff , Ltd.
Jones W. Gary
Souaya Jehanne
The Johns Hopkins University
LandOfFree
P53-induced apoptosis does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with P53-induced apoptosis, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and P53-induced apoptosis will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-2925538