Vector expressing the full-length gene of RNA virus and use...

Details Vector expressing the full-length gene of RNA virus and use... Vector expressing the full-length gene of RNA virus and use...

2000-12-22

2003-02-25

Park, Hankyel T. (Department: 1648)

Chemistry: molecular biology and microbiology

Animal cell, per se ; composition thereof; process of...

C435S005000, C435S006120, C536S023100, C536S023720

Reexamination Certificate

active

06524853

ABSTRACT:

TECHNICAL FIELD
The present invention relates to a vector which can express the full-length gene of RNA virus, an animal cell and RNA virus infected animal model which comprise the vector, and a method for screening an agent using the cell and the animal model. These are useful to elucidate the mechanisms of RNA virus replication and the development of RNA virus infections, and to develop therapeutic agents and means of treatment, and so on.
PRIOR ART
Hepatitis C virus (hereinafter, HCV) is a principal causative virus in the, development of non-A, non-B post-transfusion hepatitis (Saito, I. et al.,
Proc. Natl. Acad. Sci. USA
, 87, 6547-6549 (1990)). Since the hepatitis caused by this virus has high chronicity and may often develop into hepatocirrhosis or hepatoma, this is one of the infections for which the invention of a reliable means of treatment is urgently required. The cDNA of this virus was cloned by Choo et al. in 1989 (Choo, Q. -L., et al.,
Science
, 244, 359-362 (1989)), and it is known that the virus is a single-stranded RNA virus belonging to the family Flaviviridae (Kato, N., et al.,
Proc. Natl. Acad. Sci., USA
, 87, 9524-9528 (1990)). Several study groups have clarified its total nucleotide sequence and amino acid sequence (Kato, N., et al.,
Proc. Natl. Acad. Sci., USA
, 87, 9524-9528 (1990), Proc. Natl. Acad. Sci., USA, 88, 2451-2455 (1991),
J. Virol
., 65, 1105-1113 (1991),
J. Gen. Virol
., 72, 2697-2704 (1991),
Virology
, 188, 331-341 (1992)).
Although there are several reports on the establishment of an in vitro infection system of HCV, the real picture is that a stable infection system with repeatability which is practical enough to be utilized for the elucidation of various mechanisms of the virus or the development of means of treatment has not yet established due to problems including low reproduction amounts. (Lanford, R E, et al.,
Virology
, 202, 606(1994), Yoo, B J, et al.,
J. Virol
., 69,32(1995), Shimizu, Y K, et al.,
Proc. Natl. Acad. Sci. USA
, 89, 5477(1992), Kato, N., et al.,
Biochem. Biophys. Res. Comm
., 206, 863(1995), Batolini, L., et al.,
Res. Virol
., 144,281 (1993)).
On the other hand, there is another method for generating HCV, wherein first an RNA viral genome is generated by transcribing from the corresponding cDNA and then the virus is generated via protein synthesis (Raccaniello, V R,
Science
, 214, 916(1981),
Poliomyelitis
virus). Regarding this method also, several study groups have been working energetically, but there has not been found any practical system, just as in the case of the above-stated infection system (Mizuno, M, et al.,
Gastroenterology
, 109, 1933(1995), Dash, S., et al.,
Am. J. Pathol
., 151,363 (1997)). Furthermore, regarding small animals expressing full-length cDNA such as a transgenic mouse, it has been reported that there is a mouse expressing a part or whole cDNA, but animals which can effectively express all viral proteins are still unknown (Japanese Patent Application Laying-Open (kokai) Nos. 9-9965 and 10-84813).
OBJECTS TO BE ACHIEVED BY THE INVENTION
From the study of the present inventors, the reason why an effective amount of viral particles or viral proteins cannot be generated is considered to be that both termini of the viral genome generated in the process are not transcribed properly so that replicable full-length genes are not generated effectively.
The objects of the present invention are to construct an expression system generating a full-length virus genome, to build up an expression system which resembles more closely the replication of the original virus, and to establish cells or animal models expressing a virus from cDNA using the system.
Means to Achieve the Objects
After thorough study directed to achieve the above objects, the present inventor has succeeded in constructing a vector which can express a full-length RNA viral gene and establishing a cell strain into which the vector is integrated, thereby finally completing the present invention.
That is to say, the first aspect of the present invention relates to a vector which comprises cDNA encoding an RNA viral gene, and the vector is characterized in that it is constructed such that both termini of the RNA viral gene can be transcribed precisely and uniformly.
The second aspect of the present invention relates to an animal cell which is characterized in that it comprises the vector.
The third aspect of the present invention relates to an RNA virus infected animal model which is characterized in that it comprises the vector in a cell thereof.
The forth aspect of the present invention relates to a method for screening an agent inhibiting the replication of an RNA virus wherein the animal cell or the RNA virus infected animal model is used.
This specification includes the contents as disclosed in the specification and/or drawings of Japanese Patent Application No. 10-177820 which are priority documents of the present application.
DISCLOSURE OF THE INVENTION
The details of the present invention are disclosed below.
(1) The First Invention (a Vector)
The vector of the present invention comprises cDNA encoding an RNA viral gene, and is characterized in that it is constructed so that both termini of the RNA viral gene can be transcribed precisely and uniformly. The description “both termini . . . can be transcribed precisely” in this specification means that an RNA produced from cDNA is completely identical to a genomic RNA derived from the virus itself or does not present any differences in nucleotide sequence great enough to influence translation ability. On the other hand, “both termini . . . can be transcribed uniformly” means that the vector can produce with a certain repeatability an RNA having specific nucleotide sequences.
RNA viruses which can be used for the present invention include, but are not limited to, picornavirus such as poliovirus, coxsackievirus and echovirus; reovirus; togavirus including flavivirus such as HCV; orthomyxovirus; paramyxovirus; coronavirus; or plant RNA virus such as tobacco mosaic virus. A preferable RNA virus is HCV.
Methods of transcribing both termini of an RNA viral gene include, but are not limited to, a method wherein DNA encoding a ribozyme which is capable of cleaving the RNA viral gene by self-processing is positioned both upstream of the 5′-terminus and downstream of the 3′-terminus of the cDNA encoding the RNA viral gene.
Ribozymes cleaving an RNA viral gene by self-processing include &dgr; type hepatitis virus (Hepatitis Delta Virus: HDV) ribozyme, hammerhead ribozyme, hairpin ribozyme, artificial ribozyme obtained from in vitro and in vivo selections and the like. Regarding the nucleotide sequence of each of the above ribozymes, there is the description by Eiko Ootsuka et al.,
Protein, Nucleic Acid and Enzyme
40, 1400 (1995). In particular, the nucleotide sequence of HDV ribozyme is disclosed by Suh, Y-A., et al.,
Nucleic Acids Research
, 20, 747(1992), and that of hammerhead ribozyme is disclosed by Shimayama, T., et al.,
Biochemistry
, 34, 3649(1995). The DNA encoding the ribozyme positioned in a vector can be determined according to the kind and nucleotide sequence of the RNA virus to be used, with reference to the common nucleotide sequences described in these reference documents. Taking HCV as an example, a DNA encoding hammerhead ribozyme at the 5′-terminus side (see sequence X set forth below as an example) and a DNA encoding HDV ribozyme at the 3′-terminus side (see sequence Y set forth below as an example) are considered to be preferable.
SEQ ID NO: X
CTGATGAGGCCGAAAGGCCGAAACGGCGAAAGCCGTC (SEQ ID NO: 7)
SEQ ID NO: Y
TGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGA OGGGACCGTCCCCTCGGTAATGGCGAATGGGAC (SEQ ID NO: 8)
The vector of the present invention can be produced by, firstly preparing a DNA fragment containing two DNAs encoding the above-described ribozyme and a DNA encoding an RNA virus by PCR or the like, and secondly inserting the DNA fragment into a vector containing a proper promoter and terminator.
The vector of the present inve

Affiliated with

Also associated with

Rating

Vector expressing the full-length gene of RNA virus and use... does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Vector expressing the full-length gene of RNA virus and use..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Vector expressing the full-length gene of RNA virus and use... will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-3131579