Chemistry: molecular biology and microbiology – Vector – per se
Reexamination Certificate
1999-03-12
2001-09-11
Clark, Deborah J. R. (Department: 1633)
Chemistry: molecular biology and microbiology
Vector, per se
C424S093100, C424S093210, C424S186100, C514S04400A, C530S350000, C536S023100, C536S023500
Reexamination Certificate
active
06287856
ABSTRACT:
FIELD OF THE INVENTION
The field of the invention relates to the diagnosis of and vaccination for circovirus infections in animals.
BACKGROUND OF THE INVENTION
A family of viruses, characterized as round, non-enveloped virions with mean diameters from 17 to 23.5 nm containing circular, single-stranded deoxyribonucleic acid (ssDNA), has been named the Circoviridae, more commonly referred to as circoviruses. Six viruses have been identified as members of the family, according to The Sixth Report of the International Committee for the Taxonomy of Viruses (Lukert, P. D., G. F. de Boer, J. L. Dale, P. Keese, M. S. McNulty, J. W. Randles, and I. Tisher, 1995
, The Circoviridae
, pp. 166-168. In F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo, and M. D. Summers (eds.), Virus Taxonomy, Sixth Report of the International Committee on Taxonomy of Viruses. Arch. Virol. 10 Suppl.).
Animal viruses included in the family are chicken anemia virus (CAV; the type species), beak and feather disease virus (BFDV; also referred to as psittacine beak and feather disease virus), porcine circovirus (PCV), and pigeon circovirus. Three plant pathogens included as unclassified members of the family are the coconut foliar decay virus (CFDV), banana bunchy top virus (BBTV), and subterranean clover stunt virus (SCSV). All members of the Circoviridae have restricted host ranges. The ssDNA genome of the circoviruses represent the smallest viral DNA replicons known.
DNA sequences have previously been published for the plant viruses, CAV (Notebom, M. H. M., G. F. de Boer, D. J. van Roozelaar, C. Karreman, O. Kranenburg, J. G. Vos, S. H. M. Jeurissen, R. C. Hoeben, A. Zantema, G. Koch, H. van Ormont, and A. J. van der Eb, 1991, Characterization of cloned chicken anemia virus DNA that contains all elements for the infectious replication cycle; J. Virol. 65: 3131-3139) and PCV (Meehan, B. M., J. L. Creelan, M. S. McNulty, and D. Todd, 1997, Sequence of porcine circovirus DNA: affinities with plant circoviruses. J. Gen. Virol. 78:221-227; Buhk, H. J. and A. Mankertz, 1996, Sequence analysis of porcine circovirus; GenBank Accession no. Y0992 1). Analysis of the PCV genome indicates that it possesses an ambisense organization. The viral strand encodes a putative replication-associated protein (“Rep”), herein referred to as ORF V1, with all three sequence motifs found in molecules involved in rolling circle DNA replication, and it possesses the P-loop motif.
PCV was originally isolated in porcine kidney cell cultures and was not considered to be a pathogenic virus. In recent years, the presence of PCV has been linked to a progressive, neurological disorder in pigs, sometimes referred to as “shaky pig syndrome”. A circovirus has also been implicated in “postweaning multisystemic wasting syndrome” in swine herds in Canada. Thus, there is a need in the art to develop effective vaccines against porcine circoviruses to control these disorders.
Beak and Feather Disease (BFD) is a debilitating disease that, in its chronic phase, is characterized by feather dystrophy and loss, development of beak deformities and eventual death. Peracute and acute disease caused by the same virus are particularly common in neonatal and young birds, where death can occur within a few weeks, or even days, of the first clinical symptoms. The disease has been described in over 40 species of psittacine birds throughout the world, and new species are being added to the list each year. It is thought that the virus originated in Australian birds and spread to other continents through the worldwide movement of birds to support the companion bird industry. No known cures are available, and while vaccination is considered the best opportunity to prevent infections, no safe and economical vaccine has been available prior to this invention (Ritchie, B W 1995 Avian Viruses: Function and Control, Chapter 8, Wingers Publishing, Inc., Lake Worth, Fla.). Thus, there is a pressing need in the art to develop a vaccine to prevent this debilitating disease, particularly in companion birds.
Circovirus infections in pigeons and doves, members of the Columbiformes, have been linked to disease of the gastrointestinal tract, immune system and feathers which can lead to death (Ritchie, B W 1995, Ibid.)
The present invention addresses these needs for a vaccine against circoviruses by providing nucleic acid and subunit vaccines. Specifically, the nucleic acid sequence of the BFD virus is provided as well as a nucleic acid vaccine comprising BFDV or other circoviral nucleic acids.
SUMMARY OF THE INVENTION
The present invention provides vaccine compositions for the protection of animals against circovirus infections. Nucleic acids from beak and feather disease virus, a circovirus that infects avian species, are disclosed. Vaccine compositions comprising naked DNA or mRNA are provided. Subunit vaccines comprising recombinant proteins made from vectors comprising open reading frames from circoviruses are provided. Methods for developing nucleic acid amplification-dependent diagnostic assays, as well as the primers and probes useful in the methods, are also provided.
DETAILED DESCRIPTION OF THE INVENTION
As used herein, the term “polypeptide” refers to a polymer of amino acids and includes full-length proteins and fragments thereof, including peptides.
As used herein, the term “circovirus” refers to a non-enveloped virion containing a circular, single-stranded DNA which is capable of infecting animal cells.
As used herein, “a” or “an” can mean one or more, depending upon the context in which it is used.
The present invention specifically includes the discovery of the nucleic acid sequence of the BFDV genome. The herein disclosed discovery of the nucleic acid sequence of the BFDV genome has allowed a comparison at the genomic level of three animal viruses in the Circoviridae. The comparison reveals that the BFDV and PCV genomes are strikingly similar, while the sequence of a third member, CAV, is more divergent.
For example, the non-coding regions of the PCV and BFDV genomes contain a stem-loop structure, very similar to the so-called structurally conserved element (SCE) in geminiviruses, that is involved in both DNA replication and in control of viral gene expression. In circoviruses, the SCE, which is a stem-loop structure, is flanked by iterated sequences, similar to the iterons described in geminivirus genomes (Arguello-Astorga, G. R., R. G. Guevara-Gonsalez, L. R. Herrera-Estrella, and R. F. Rivera-Bustamante, 1994, Geminivirus replication origins have a group-specific organization of iterative elements: a model for replication; Virology 203:90-100; Mankertz, A., F. Persson, J. Mankertz, G. Blaess, and H.-J. Buhk, 1997. Mapping and characterization of the origin of DNA replication of porcine circovirus. J. Virol. 71:2562-2566). The sequence of the PCV stem-loop structure is: AAGTGCGCTGCTGTAGTATTACCAGCGCACTT (SEQ ID NO:5). The sequence of the BFDV stem-loop structure is:
AGGCGGCGGTTAGTATTACCCGCCGCCT (SEQ ID NO:6).
Another similarity of the BFDV and PCV genome organizations is the arrangement of the coding sequences on the two strands. The Rep protein is encoded by the major viral strand, while the viral capsid or coat protein is encoded on the complementary strand.
Interestingly, consensus TATA sequences are found upstream of the capsid genes (ORF C1), but not in association with the Rep protein genes (ORF V1). Based on the striking similarity between the PCV and BFDV non-coding regions, this invention discloses that a serine codon (TCT) may be used by the psittacine host protein synthesis machinery for initiation of translation.
The PCV and BFDV genomes encode several polypeptide sequences, ranging in approximate size from 8 to 35 kD, as identified by the GeneRunner software program (Hastings Software, Inc., Hastings, N.Y.), Clone Manager (Scientific and Educational Software, State Line Pa.), or the GCG suite of programs. Overall, a comparison of the PCV and BFDV genomes reveals 36% identity at the nucleic acid level.
Lukert Phil D.
Niagro Frank D.
Poet Steven E.
Ritchie Branson W.
Clark Deborah J. R.
Needle & Rosenberg P.C.
Sorbello Eleanor
University of Georgia Research Foundation Inc.
LandOfFree
Vaccines against circovirus infections does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Vaccines against circovirus infections, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Vaccines against circovirus infections will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-2539435