TRPM-2 antisense therapy using an oligonucleotide having...

Drug – bio-affecting and body treating compositions – Designated organic active ingredient containing – Carbohydrate doai

Reexamination Certificate

Rate now

  [ 0.00 ] – not rated yet Voters 0   Comments 0

Details

Reexamination Certificate

active

06900187

ABSTRACT:
A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2′-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2′-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.

REFERENCES:
patent: 5789389 (1998-08-01), Tarasewicz et al.
patent: 6172216 (2001-01-01), Bennett et al.
patent: 6335194 (2002-01-01), Bennett et al.
patent: 6383808 (2002-05-01), Monia et al.
patent: WO 00/49937 (2000-08-01), None
patent: WO 01/46455 (2001-06-01), None
patent: WO 02/22835 (2002-03-01), None
patent: WO 03/062421 (2003-07-01), None
patent: WO 03/072591 (2003-09-01), None
Buttyan et al., “Induction of the TRPM-2 Gene in Cells Undergoing Programmed Death”Molecular and Cellular BiologyAug. 1989, vol. 9, No. 8, pp. 3473-3481.
Miller et al., “Localization of mRNAs by in-situ hybridization to the residual body at stages IX-X of the cycle of the rat seminiferous epithelium: fact or artefact?”International Journal of Andrology, 17:149-160.
Darby et al., “Vascular Expression of Clusterin in Experimental Cyclosporine Nephrotoxicity”Exp Nephrol1995; 3:234-239.
Milner et al., “Selecting effective antisense reagents on combinatorial oligonucleotide arrays”Nature Biotechnologyvol. 15, Jun. 1997, pp. 537-541.
Sensibar et al., “Prevention of Cell Death Induced by Tumor Necrosis Factor alpha in LNCaP Cells by Overexpression of Sulfated Glycoprotein-2 (Clusterin),”Cancer Research, Jun. 1, 1995, vol. 55, pp. 2431-2437.
Miyake et al., “Testosterone-repressed Prostate Message-2 Is an Antiapoptotic Gene Involved in Progression to Androgen Independence in Prostate Cancer”,Cancer Research 60, Jan. 1, 2000, pp. 170-176.
Yang et al., “Nuclear clusterin/XIP8, an x-ray-induced Ku70-binding protein that signals cell death”,Proc. Nat'l. Acad. Sci. USA, vol. 97, Issue 11, pp 5907-5912, May 23, 2000.
Benner, et al., “Combination of Antisense Oligonucleotide and Low-Dose Chemotherapy in Hematological Malignancies”,Journal of Pharmacological and Toxicological Method, 37:229-235 (1997).
Kadomatsu, et al, “Expression of sulfated glycoprotein 2 is associated with carcinogenesis induced by N-nitroso-N-methylurea in rat prostate and seminal vesicle”,Cancer ResApr. 1, 1993, 53(7):1480-1483.
Kyprianou, et al., “bcl-2 over-expression delays radiation-induced apoptosis without affecting the clonogenic survival of human prostate cancer cells.”,Int J Cancer, Jan. 27, 1997, 70(3):341-348.
Wright, et al., “A ribonucleotide reductase inhibitor, MDL 101,731, induces apoptosis and elevates TRPM-2 mRNA levels in human prostate tumor xenografts.”,Exp Cell Res, Jan. 10, 1996, 222(1):54-60.
Bruchovsky, et al., “Control of tumor progression by maintenance of apoptosis.”,Prostate Suppl., 1996, 6:13-21.
Gleave et al., Use of Antisense Oligonucleotides Targeting the Antiapoptotic Gene, Clusterin/Testosterone-Repressed Prostate Message 2, To Enhance Androgen Sensitivity and Chemosensitivity in Prostate Cancer, Urology, 2001, pp. 39-49, vol. 58.
Gleave et al., Antisense therapy: Current status in prostate cancer and other malignancies, Cancer and Metastasis Reviews, pp. 79-92, vol. 21.
Gleave et al., Targeting anti-apoptotic genes upregulated by androgen withdrawal using antisense oligonucleotides to enhance androgen-and chemo-sensitivity in prostate cancer, Investigational New Drugs, 2002, pp. 145-158, vol. 20, No. 2, XP 009021411.
Gleave et al., Antisense Targets to Enhance Hormone and Cytotoxic Therapies in Advanced Prostate Cancer, Current Drug Targets, pp. 209-221, vol. 4.
Jones et al., Molecules in focus. Clusterin, The International Journal of Biochemistry & Cell Biology, 2002, pp. 427-431, vol. 34, XP002262319.
Miyake et al., Antisense TRPM-2 Oligonucleotides Chemosensitize Human Androgen-Independent PC-3 Prostate Cancer Cells Both in Vitro and in Vivo1, Clinical Cancer Research, May 1, 2000, pp. 1655-1663, vol. 6.
Miyake et al., Testosterone-repressed Prostate Message-2 Is an Antiapoptotic Gene Involved In Progression to Androgen Independence in.Prostate Cancer1, Cancer Research, Jan. 1, 2000, pp. 170-176, vol. 60.
Miyake et al., Synergistic Chemsensitization and Inhibition of Tumor Growth and Metastasis by the Antisense Oligodeoxynucleotide Targeting Clusterin Gene in a Human Bladder Cancer Model1, Clinical Cancer Research, pp 4245-4252, vol. 7.
Miyake et al., Novel therapeutic strategy for advanced prostate cancer using antisense oligodeoxynucleotides targeting antiapoptotic genes upregulated after androgen withdrawal to delay androgen-independent progression and enhance chemosensitivity, International Journal of Urology,, pp. 337-349, vol. 8, No. 7.
Rosenberg et al., Cluster: Physiologic and Pathophysiologic Considerations, International Journal of Biochemistry Cell Biology, pp. 633-645, vol. 27, No. 7.
Wilson et al., Clusterin is a secreted mammalian chaperone, Trends in Biological Sciences, Mar. 1, 2000, pp 95-98, vol. 25, No. 3, XP004202536.
Wong et al., Molecular characterization of human TRPM-2/clusterin, a gene associated with sperm maturation, apoptosis and neurodegeneration, European Journal of Biochemistry, pp. 917-925, vol. 227, No. 3, XP 001146404.
Zangemeister-Wittke et al., A Novel Bispecific Antisense Oligonucleotide Inhibiting Bothbcl-2andbcl-xLExpression Efficiently Induces Apoptosis in Tumor Cells1, Clinical Cancer Research, Jun. 1, 2000, pp. 2547-2555, vol. 6.
Zellweger et al., Antitumor Activity of Antisense Clusterin Oligonucleotides is Improved in Vitro and in Vivo by Incorporation of 2′-O-(2-Methoxy)Ethyl Chemistry, The Journal of Pharmacology and Experimental, May 11, 2001, pp. 934-940, vol. 298, No. 3.
Zellweger et al., Chemosensitization of Human Renal Cell Cancer Using Antisense Oligonucleotides Targeting the Antiapoptotic Gene Clusterin1, Neoplasia, , pp. 360-367, vol. 3, No. 4.
Nör et al.; Up-Regulation of Bcl-2 in Microvascular Endothelial Cells Enhances Intratumoral Angiogenesis and Accelerates Tumor Growth; Cancer Research; vol. 61; Mar. 1, 2001; 2183-2188.
Kirby et al.; Bartonella-Associated Endothelial Proliferation Depends on Inhibition of Apoptosis; PNAS; vol. 99, No. 7; Apr. 2, 2002; 4656-4661.
Cox et al.; Angiogenesis and Non-Small Cell Lung Cancer; Lung Cancer; vol. 27, 2000; 81-100.
Tran et al.; A Role for Survivin in Chemoresistance of Endothelial Cells Mediated by VEGF; PNAS; vol. 99, No. 7; Apr. 2, 2002; 4349-4354.
Nör et al.; Engineering and Characterization of Functional Human Microvessels in Immunodeficient Mice; Laboratory Investigation; vol, 81, No. 4; Apr. 2001; 453-463.
Boral et al.; Clinical Evaluation of Biologically Targeted Drugs: Obstacles and Opportunities; Cancer Chemother Pharmacol; vol. 42; 1998, S3-S21.
Zwain et al.; Clusterin Protects Granulosa Cells from Apoptotic Cell Death During Follicular Atresia; Experimental Cell Research; vol. 257; 2000; 101-110.
Lee et al.; In Vitro Models of Prostate Apoptosis: Clusterin as an Antiapopotic Mediator: The Prostate Supplement; vol. 9; 2000; 21-24.
Genta Incorporated; New Data Reaffirm Genta's Molecular Target as Critical Factor for Enhancing Anticancer Treatment; www.genta.com: 2001.

LandOfFree

Say what you really think

Search LandOfFree.com for the USA inventors and patents. Rate them and share your experience with other people.

Rating

TRPM-2 antisense therapy using an oligonucleotide having... does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with TRPM-2 antisense therapy using an oligonucleotide having..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and TRPM-2 antisense therapy using an oligonucleotide having... will most certainly appreciate the feedback.

Rate now

     

Profile ID: LFUS-PAI-O-3406653

  Search
All data on this website is collected from public sources. Our data reflects the most accurate information available at the time of publication.