TRPM-2 antisense therapy

Drug – bio-affecting and body treating compositions – Designated organic active ingredient containing – Carbohydrate doai

Reexamination Certificate

Rate now

  [ 0.00 ] – not rated yet Voters 0   Comments 0

Details

C536S024500, C536S023100

Reexamination Certificate

active

07732422

ABSTRACT:
Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Seq ID No. 4 (cagcagcagagtcttcatcat) is an antisense oligonucleotide which inhibits expression of TRPM-2 by tumor cells, and which can be combined with a pharmaceutically acceptable carrier suitable for human administration.

REFERENCES:
patent: 5563255 (1996-10-01), Monia et al.
patent: 5646042 (1997-07-01), Stinchcomb et al.
patent: 5789389 (1998-08-01), Tarasewicz et al.
patent: 5801154 (1998-09-01), Baracchini et al.
patent: 5877309 (1999-03-01), McKay et al.
patent: 5929040 (1999-07-01), Werther et al.
patent: 5945290 (1999-08-01), Cowsert
patent: 5998148 (1999-12-01), Bennett et al.
patent: 6172216 (2001-01-01), Bennett et al.
patent: 6335194 (2002-01-01), Bennett et al.
patent: 6383808 (2002-05-01), Monia et al.
patent: WO 00/49937 (2000-08-01), None
patent: WO 01/46455 (2001-06-01), None
patent: WO 02/22635 (2002-03-01), None
patent: WO 03/062421 (2003-07-01), None
patent: WO 03/072591 (2003-09-01), None
Nor et al., Up-regulation of Bcl-2 in microvascular endothelial cells enhances intratumoral angiogenesis and accelerates tumor growth, Cancer Research, Mar. 1, 2001, pp. 2183-2188, vol. 61.
Nor et al., Engineering and characterization of functional human microvessels in immunodeficient mice, Laboratory Investigation, Apr. 2001, pp. 453-463, vol. 81, No. 4.
Opalinska et al., Nucleic-acid therapeutics: basic principles and recent applications, Nature Reviews Drug Discovery, Jul. 2002, pp. 503-514, vol. 1.
Raghavan et al., Evolving Strategies of Cytotoxic Chemotherapy for Advanced Prostate Cancer, European Journal of Cancer, 1997, pp. 566-574, vol. 33, No. 4.
Rosenberg et al., Clusterin: physiologic and pathophysiologic considerations, Int. J. Biochem. Cell Biol., 1995, pp. 633-645, vol. 27, No. 7.
Sensibar et al., Prevention of cell death induced by tumor necrosis factor α in LNCaP cells by overexpression of sulfated glycoprotein-2 (clusterin), Cancer Research, 1995, pp. 2431-2437, vol. 55.
Tran et al., A role for survivin in chemoresistance of endothelial cells mediated by VEGF, PNAS, Apr. 2, 2002, pp. 4349-4354, vol. 99, No. 7.
Wilson et al., Clusterin is a secreted mammalian chaperone, TIBS, Mar. 2000, pp. 95-98, vol. 25.
Wong et al., Molecular characterization of human TRPM-2/clusterin, a gene associated with sperm maturation, apoptosis and neurodegeneration, European Journal of Biochemistry, 1994, pp. 917-925, vol. 227, No. 3.
Wright et al., A ribonucleotide reductase inhibitor, MDL 101,731, induces apoptosis and elevates TRPM-2 mRNA levels in human prostate tumor xenografts, Experimental Cell Research, Jan. 10, 1996, pp. 54-60, vol. 222, No. 1.
Yang et al. Nuclear clusterin/XIP8, an x-ray-induced Ku70-binding protein that signals cell death, PNAS, May 23, 2000, pp. 5907-5912, vol. 97, No. 11.
Zangmeister-Wittke et al., A novel bispecific antisense oligonucleotide inhibiting both bcl-2 and bcl-xL expression efficiently induces apoptosis in tumor cells, Clinical Cancer Research, Jun. 2000, pp. 2547-2555, vol. 6.
Zellweger et al., Antitumor activity of antisense clusterin oligonucleotides is improved in vitro and in vivo by incorporation of 2′-O-(2-methoxy) ethyl chemistry, The Journal of Pharmacology and Experimental Therapeutics, 2001, pp. 934-940, vol. 298, No. 3.
Zellweger et al. , Chemosensitization of human renal cell cancer using antisense oligonucleotides targeting the antiapoptotic gene clusterin, Neoplasia, 2001, pp. 360-367, vol. 3, No. 4.
Zwain et al., Clusterin protects granulosa cells from apoptotic cell death during follicular atresia, Experimental Cell Research, 2000, pp. 101-110, vol. 257.
Gleave et al., Targeting anti-apoptotic genes upregulated by androgen withdrawal using antisense oligonucleotides to enhance androgen- and chemo-sensitivity in prostate cancer, Investigational New Drugs, 2002, pp. 145-158, vol. 20.
Gleave et al., Antisense targets to enhance hormone and cytotoxic therapies in advanced prostate cancer, Current Drug Targets, 2003, pp. 209-221, vol. 4.
Ho et al., Lack of Association between Enhanced TRPM-2/Clusterin Expression and Increased Apoptotic Activity in Sex-Hormone-Induced Prostatic Dysplasia of the Noble Rat, American Journal of Pathology, Jul. 1998, pp. 131-139, vol. 153, No. 1.
Jen et al. Suppression of gene expression by targeted disruption of messenger RNA: available options and current strategies, Stem Cells, 2000, pp. 307-319, vol. 18.
Jones et al., Molecules in focus: clusterin, The International Journal of Biochemistry & Cell Biology, 2002 pp. 427-431, vol. 34.
Kadomatsu et al., Expression of sulfated glycoprotein 2 is associated with carcinogenesis induced by N-nitroso-N-methylurea in rat prostate and seminal vesicle, Cancer Res, Apr. 1, 1993, pp. 1480-1483, vol. 53, No. 7.
Kang et al., Antisense oligonucleotide of clusterin mRNA induces apoptotic cell death and prevents adhesion of rat ASC-17D sertoli cells, Molecules and Cells, Apr. 30, 2000, pp. 193-198, vol. 10, No. 2.
Kirby et al. , Bartonella-associated endothelial proliferation depends on inhibition of apoptosis, PNAS, Apr. 2, 2002, pp. 4656-4661, vol. 99, No. 7.
Kyprianou et al., bcl-2 over-expression delays radiation-induced apoptosis without affecting the clonogenic survival of human prostate cancer cells, International Journal of Cancer, Jan. 27, 1997, pp. 341-348, vol. 70, No. 3.
Lee et al, in vitro models of prostate apoptosis: clusterin as an antiapoptotic mediator, The Prostate Supplement, 2000, pp. 21-24, vol. 9.
Millar et al., Localization of mRNAs by in-situ hybridization to the residual body at stages IX-X of the cycle of the rat seminiferous epithelium: fact or artefact?, International Journal of Andrology, 1994, pp. 149-160, vol. 17.
Milner et al., Selecting effective antisense reagents on combinatorial oligonucleotide arrays, Nature Biotechnology, 1997, pp. 537-541, vol. 15.
Miyake et al., Testosterone-repressed prostate message-2 is an antiapoptotic gene involved in progression to androgen independence in prostate cancer, Cancer Research, Jan. 1, 2000, pp. 170-176, vol. 60.
Miyake et al., Acquisition of chemoresistant phenotype by overexpression of the antiapoptotic gene testosterone-repressed prostate message-2 in prostate cancer, Cancer Research, May 1, 2000, pp. 2547-2554, vol. 60.
Miyake et al., Antisense TRPM-2 oligodeoxynucleotides chemosensitize human androgen-independent PC-3 prostate cancer cells both in vitro and in vivo, Clinical Cancer Research, May 2000, pp. 1655-1663, vol. 6.
Miyake et al., Synergistic chemsensitization and inhibition of tumor growth and metastasis by the antisense oligodeoxynucleotide targeting clusterin gene in a human bladder cancer model, Clinical Cancer Research, Dec. 2001, pp. 4245-4252, vol. 7.
Miyake et al., Novel therapeutic strategy for advanced prostate cancer using antisense oligodeoxynucleotides targeting antiapoptotic genes upregulated after androgen withdrawal to delay androgen-independent progression and enhance chemosensitivity, International Journal of Urology, 2001, pp. 337-349, vol. 8.
Miyake et al., Antisense oligodeoxynucleotide therapy targeting clusterin gene for prostate cancer: Vancouver experience from discovery to clinic, International Journal of Urology, Sep. 2005, pp. 785-794, vol. 12, No. 9.
Moulson et al., Clusterin (Apo J) regulates vascular smooth muscle cell differentiation in vitro, Journal of Cellular Physiology, 1999, pp. 355-364, vol. 180.
Agrawal et al., Antisense Therapeutics: is it as simple as complementary base recognition, Molecular Medicine Today, 2000, pp. 72-81, vol. 6, Publisher: Elsevier Science Ltd.
Bailey et al., Clusterin in the male reproductive system: localization and possible function, Molecular and Cellular Endocrinology, 1999, pp. 17-23, vol. 151.
Benner et al., Combination of Antisense Oligonucleotide and Low-Dose Chemotherapy in Hematological Malignancies, Journal of Pharmacological and Toxicological Methods, 1997, pp. 229-235.
Boral et al., Clinical evaluation of biologically targeted drugs: obstacles and opportunities, Ca

LandOfFree

Say what you really think

Search LandOfFree.com for the USA inventors and patents. Rate them and share your experience with other people.

Rating

TRPM-2 antisense therapy does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with TRPM-2 antisense therapy, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and TRPM-2 antisense therapy will most certainly appreciate the feedback.

Rate now

     

Profile ID: LFUS-PAI-O-4180198

  Search
All data on this website is collected from public sources. Our data reflects the most accurate information available at the time of publication.