Tripeptidylpeptidase inhibitors

Details Tripeptidylpeptidase inhibitors Tripeptidylpeptidase inhibitors

1998-02-19

2002-06-11

Low, Christopher S. F. (Department: 1653)

Drug, bio-affecting and body treating compositions

Designated organic active ingredient containing

Peptide containing doai

C562S553000, C562S575000, C540S476000

Reexamination Certificate

active

06403561

ABSTRACT:

BACKGROUND OF THE INVENTION
The subject of the invention is also physiologically acceptable compositions comprising the said compounds.
The subject of the invention is also the use of the said compounds in the preparation of drugs intended for man or animals.
The important physiological role of endogenous neuropeptides, and in particular that of cholecystokinin (CCK), is known. This neuropeptide is both a digestive hormone and a neurotransmitter in the central and peripheral nervous systems. In the latter case, it is mainly in the form of an octapeptide sulphate (CCK-8-S) corresponding to the formula:
Asp-Tyr (SO
3
H)-Met-Gly-Trp-Met-Asp-Phe-NH
2
, (SEQ ID NO: 7)
CCK exerts various actions on motricity and digestive secretions (contraction of the bile vesicle, inhibition of gastric secretion, etc.) as well as on the central nervous system (analgesia, action on moods and cognition) and on the endocrine system (hypophyseal secretions). In addition, CCK and certain derivatives have a powerful anorexigenic activity by facilitating satiation by means of stimulating peripheral, and possibly central, receptors (J. J. Vanderhaegen and J. M. Crawley, Ann. N.Y. Acad. Sci., 1985, 448: 1-697).
Although interesting effects might be expected from the pharmacological stimulation of CCK receptors, no agent which stimulates these receptors is currently therapeutically available, mainly for reasons of poor bioavailability of CCK and derivatives thereof. In addition, it has even been shown that direct stimulation of CCK receptors was liable to lead to undesirable anxiogenic effects.
Other studies have been geared towards identifying the enzyme(s) responsible for the physiological inactivation of these endogenous neuropeptides and in particular CCK.
Accordingly, the involvement has been suggested of various enzymes which are thought to attack certain peptide bonds in the molecule CCK-8, such as, in particular, that of an acidic aminopeptidase, which is distinct from aminopeptidase A (Deschodt-Lanckman et al., Peptides, 1983, 4: 71), of enkephalinase and of an aminopeptidase (Matsas et al., FEBS Lett., 1984, 175: 124; Deschodt-Lanckman et al., Regul. Peptides, 1981, 2: 15), that of thiolpeptidases (Mc Dermott et al., Neurochem. Int., 1983, 5: 641; Durieux et al., Neuropeptides, 1986, 7: 1) as well as that of a metalloendopeptidase (Steardo et al., J. Neurochem., 1985, 45: 784).
More recently, Rose et al. (Proc. Natl. Acad., Sci. USA, 1988, 85: 8326; Neurosci., 1989, 29: 583) have suggested the involvement of a serine peptidase. They also observed that general reagents for the serine groups of proteins, such as diisopropyl fluorophosphorate (DFP) or elastase-inhibiting boronic acids or chloromethyl ketones (a family of serine peptidases) were capable of preventing the enzymatic degradation of endogenous CCK-8 released by depolarization of slices of brain.
However, these experiments did not allow the enzyme responsible to be identified and purified, and the compounds used in these experiments in vitro should not be considered as drugs, in particular on account of their toxicity, their absence of specificity and/or their poor bioavailability.
More recently still, an enzyme has been purified and identified from soluble extracts of human brain (Wilson C. et al., Neurochem. Res. 1993, 18(7), 743-749), this enzyme having much similarity with a protease known as tripeptidylpeptidase TPP II previously isolated from rat liver or from human erythrocytes (Balow R. M. et al., J. Biol. Chem., 1986, 261: 2409-2417; Tomkinson B. et al., Biochemistry 1991, vol. 30, 168-174). The 4611-bp sequence of a mouse TPP II has also been described (Tomkinson B., Biochem. J., 1994, vol. 304: 517-523), the coding sequence of which shows great homology with the abovementioned human TPP II.
This purified enzyme was shown to be capable of hydrolysing several neuropeptides including exogenous CCK-8, but neither its application in the inactivation of endogenous CCK-8 nor the possibility of obtaining CCK-type biological responses by inhibiting it had been either demonstrated or even suggested.
Thus, it is seen that there is a need in the prior art for specific, bioavailable, non-toxic chemical compounds which can be used as drugs for preventing the inactivation of these endogenous neuropeptides.
Moreover, a TPP II inhibitor of weak affinity has been described (Tomkinson et coll., Arch. Biochem. Biophys., 1994, 314: 276), but this inhibitor has an oligopeptidergic structure, which raises the idea that its bioavailability is low, especially orally, and that it therefore cannot constitute a drug, this use, incidentally, not having been considered by the authors.
The invention has now made it possible to achieve this objective by providing, in particular, a process for screening drugs which uses the isolated enzyme responsible, thus making it possible, depending on whether the said enzyme is or is not inhibited, to distinguish molecules liable to constitute effective drugs in the treatment of disorders or complaints involving endogenous neuropeptides, and in particular cholecystokinin.
The present invention also provides chemical compounds of formula defined below, which can be used to prevent the inactivation of endogenous neuropeptides, and thus satisfies the essential need existing in the prior art.
The inventors have prepared a pure membrane-derived tripeptidylpeptidase according to a process comprising the following steps:
i) preparation of membranes from brain (cerebral cortex), for example from rat brain;
ii) purification by high performance liquid chromatography/ies (HPLC);
iii) checking of the product obtained, by enzymatic reaction using a CCK substrate, for example the peptides CCK-8 (non-sulphated) of formula:
Asp-Tyr-Met-Gly-Trp-Met-Asp-Phe-NH
2
(SEQ ID NO: 7)
or CCK-5 of formula:
Gly-Trp-Met-Asp-Phe-NH
2
(SEQ ID NO: 8)
Studying the specificity of this purified enzyme on a series of model substrates showed that it behaves like an aminotripeptidylpeptidase.
The inventors have carried out sequencing work. One fragment of the purified protein is highly similar to a protease known as tripeptydylpeptidase II isolated previously from human erythrocytes or from rat liver (Balöw R. M. et al., and Tomkinson et al.).
Using traditional molecular cloning methods, the inventors identified two distinct clones in a library of rat brain complementary DNA using two probes A and B of 350 and 380 bases respectively. They were obtained by a polymerase chain reaction (PCR) performed using the following primers:
SEQ ID No. 3 (probe A, sense primer): GACTGAGGAGCCCTTCCCTTTTCA
SEQ ID No. 4 (probe A, antisense primer): GCCTTAGGATAGAAGTCATAGCCA
SEQ ID No. 5 (probe B, sense primer): CCCTTTGTAGGAAAGGTTGTGCC
SEQ ID No. 6 (probe B, antisense primer): GAATACGCAATAATCGGGAGGATAC
Their sequencing indicated that the first clone is the rodent homologue of human tripeptidylpeptidase II (TPP II). On the other hand, in the second, the sequence differs in the 5′ part (starting from nucleotide 293).
The nucleotide sequence coding for the isolated protein is given by the identifiers (SEQ ID No. 1 and SEQ ID No. 2).
The sequence includes a hydrophobic segment of about twenty amino acids, indicating the existence of a transmembrane segment. Thus, although this protein is probably derived from the same gene as the above one by a process of alternative splicing, it presents itself as a serine ectopeptidase.
Thus, the subject of the present invention is a process for screening drugs by measuring the activity of the membrane-bound tripeptidylpeptidase II enzyme or homologue, by using a model substrate for this enzyme.
Tripeptidylpeptidase can be prepared in accordance with the abovementioned process.
According to another embodiment, brain membranes, prepared by simple centrifugation of a homogenate, are incubated in the presence of an aminotripeptidylpeptidase substrate (such as AAF-Amc) and potential inhibitors of the enzymatic activity thus revealed.
The term homologous enzyme is understood to refer both to tripeptidylpeptidases which might be genetically modif

Affiliated with

Also associated with

Rating

Tripeptidylpeptidase inhibitors does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Tripeptidylpeptidase inhibitors, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Tripeptidylpeptidase inhibitors will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-2902111