Trans-activation of transcription from viral RNA

Details Trans-activation of transcription from viral RNA Trans-activation of transcription from viral RNA

1998-06-01

2002-08-13

Nelson, Amy J. (Department: 1638)

Multicellular living organisms and unmodified parts thereof and

Method of introducing a polynucleotide molecule into or...

C435S069100, C435S320100, C435S468000, C435S469000, C435S470000, C536S023100, C800S288000, C800S292000, C800S293000, C800S294000, C800S298000, C800S301000

Reexamination Certificate

active

06433248

ABSTRACT:

FIELD OF THE INVENTION
The present invention concerns inducible promoters and trans-activators for such inducible promoters, along with recombinant organisms such as plants containing the same.
BACKGROUND OF THE INVENTION
RNA has been shown to perform many of the functions that were once thought restricted to proteins. RNA molecules can function as nucleases, as demonstrated by the self-cleavage of RNA introns and the catalytic RNA of RNase P (K. Kruger et al.,
Cell
31, 147 (1982); S. Altman, L. Kirsebom, S. Talbot,
FASEB J.
7, 7 (1993)). RNA molecules can also catalyze peptide bond formation and perform the functions of a kinase, a ligase and an RNA polymerase (B. Zhang and T. R. Cech,
Nature
390, 96 (1997); J. R. Lorsch and J. W. Szostak,
Nature
371, 31 (1994); E. H. Ekland, J. W. Szostak, D. P. Bartel,
Science
269, 364 (1995); J. A. Doudna, S. Couture, J. W. Szostak,
Science
251, 1605 (1991)). Given this diversity of functions, it is not surprising that mRNAs themselves can mediate gene expression at the translational level (D. R. Gallie,
Plant Mol. Biol.
32, 145 (1996)).
Non-coding RNAs as well as the 3′ untranslated regions (3′ UTR) of cellular mRNAs have also been shown to function as trans-acting regulators (riboregulators) of cell division and differentiation (F. Rastinejad, M. J. Conboy, T. A. Rando, H. M. Blau,
Cell
75, 1107 (1993); M. D. Crespi et al,
EMBO J.
13, 5099 (1994); C. J. Decker and R. Parker,
Curr. Opin. Cell Biol.
7, 386 (1995); E. R. Jupe et al.,
Cell Growth
&
Diff.
7, 871 (1996)). In
Caenorhabditis elegans,
the small non-coding lin-4 RNAs can interact with the 3′ UTR of lin-14 mRNAs to alter gene expression by affecting their stability and/or translatability (R. C. Lee, R. L. Feinbaum, V. Ambros,
Cell
75, 843 (1993); B. Wightnan, I. Ha, G. Ruvkin,
Cell
75, 855 (1993)). Surprisingly, however, the regulation of RNA transcription by another RNA species has not been observed.
SUMMARY OF THE INVENTION
A method of activating transcription of an RNA of interest in a cell, in vitro or in vivo, comprises: (a) providing a host cell containing a heterologous construct, the heterologous construct comprising an RNA virus subgenomic promoter operatively associated with a heterologous RNA of interest, wherein the promoter does not initiate transcription of the heterologous RNA in the absence of a corresponding RNA virus trans-activating RNA segment, and wherein the RNA virus trans-activating RNA segment is absent from the host cell; and then (b) introducing a trans-activating nucleic acid segment into the host cell so that transcription of the heterologous RNA is initiated. The cell is preferably a plant cell, such as a dicot plant The trans-activating segment may be introduced into the cell by any suitable means, such as electroporation, by infecting the cell with a virus, which virus expresses the trans-activating RNA, or by even adding the segment to a culture solution containing plants or plant cells in vitro in which heterologous proteins are being produced.
A second aspect of the invention is an isolated nucleic acid encoding an RNA virus trans-activating RNA (e.g., an RNA or a DNA such as a cDNA encoding the RNA, or a synthetic oligonucleotide). Examples of such nucleic acids include:
(a) an RNA containing the sequence: UCAAUCAGAGGUAUCGCCCCGCCUCUCAGUGUUG (SEQ ID NO:1)
(b) an RNA containing the sequence: AGAGGUAUCGCCCCGCCUCUC (SEQ ID NO:2); and
(c) a DNA encoding an RNA of (a) or (b) above. The nucleic acid is preferably at least 15, 18 or 20 nucleotides in length, and in one embodiment is preferably not more than 40, 50 or 60 nucleotides in length. In another embodiment, the nucleotide may be incorporated into a longer molecule up to 400, 500, or 600 nucleotides in length or more. Fragments of (a) to (c) above which retain trans-activating activity are thus included within the invention. The nucleic acids may be incorporated into constructs of the foregoing operatively associated with a heterologous promoter (e.g., an inducible promoter), and the constructs provided on vectors for transient transfection or stable transformation of host cells as described in greater detail below.
Also disclosed is a method of activating transcription of an RNA of interest in a plant. The method comprises: (a) transforming a plant cell with a vector comprising heterologous construct, the heterologous construct comprising a plant RNA virus subgenomic promoter operatively associated with a heterologous nucleic acid of interest to provide a transformed plant cell, wherein the promoter does not initiate transcription of the heterologous nucleic acid in the absence of a corresponding RNA virus trans-activating RNA segment, and wherein the RNA virus trans-activating RNA segment is absent from the plant cell; then (b) regenerating a plant from the transformed plant cell; and then (c) infecting the plant with a viral or bacterial vector that transcribes the trans-activating RNA segment in the cells of the plant so that transcription of the heterologous nucleic acid in the cells of the plant is initiated. The transforming step may be carried out by any suitable means, but is preferably carried out in a manner that causes the heterologous construct to be stably integrated into the genome of the plant. Suitable means include transformation with ballistic vectors, electroporation, transformation with Agrobacterium vectors such as
Agrobacterium tumefaciens
or
Agrobacterium rhizogenes
vectors, and with DNA virus vectors. The infecting step may likewise be carried out by any suitable means, such as with an with an RNA virus vector, a DNA virus vector, or an Agrobacterium vector.
The invention is explained greater detail in the drawings herein and the specification below.


REFERENCES:
Jeong et al, J. Virol., vol. 68, pp. 2615-2623, 1994.*
Bates; Electroporation of Plant Protoplasts and Tissues,Methods In Cell Biology, 50:363-373 (1995).
Brisson et al.; Expression of a bacterial gene in plants by using a viral vector,Nature, 310:511-514 (1984).
Düring et al.; Synthesis and self-assembly of a functional monoclonal antibody in transgenicNicotiana tabacum, Plant Molecular Biology, 15:281-293 (1990).
Mariani et al.; Induction male sterility in plants by a chimaeric ribonuclease gene,Nature, 347:737-741 (1990).
Miki et al.;Procedures for Introducing Foreign DNA into Plants,Methods in Plant Molecular Biology and Biotechnology, Chapter 6:67-88 (1993).
Opperman et al.; Root-Knot Nematode—Directed Expression of a Plant Root-Specific Gene,Science, 263:221-223 1994.
Siegel et al.; Sequence-specific recognition of a subgenomic RNA promoter by a viral RNA polymerase,Proc. Natl. Acad. Sci. USA, 94:11238-11243 (1997).
Sit, et al.;RNA—Mediated Trans-Activation of Transcription from a Viral RNA,Science, 281:829-832 (1998).
Xiong et al.; The Complete Nucleotide Sequence and Genome Organization of Red Clover Necrotic Mosaic Virus RNA—1,Virology, 171:543-554 (1989).
Zavriev et al.; Mapping of the Red Clover Necrotic Mosaic Virus Subgenomic RNA,Virology, 216:407-410 (1996).
PCT International Search Report for International application No. PCT/US99/10533 (Sep. 29, 1999).
Sit et al.; RNA—Mediated Trans-Activation of Transcription from a Viral RNA,Science, 281:829-832 (Aug. 7, 1998 Reprint Series).
Zavriev et al.; Mapping of the Red Clover Necrotic Mosaic Virus Subgenomic RNA,Virology, 216 (Article No. 0076):407-410 (1996).
Vaewhongs et al.; Virion Formation I s Required for the Long-Distance Movement of Red Clover Necrotic Mosaic Virus in Movement Protein Transgenic Plant,Virology, 212:607-613 (1995).
Maia et al.; Gene Expression from Viral RNA Genomes,Plant Molecular Biology, 32:367-391 (1996).
Zaccomer et al.; The Remarkable Variety of Plant RNA Virus Genomes,J. of General Virology, 76:231-247 (1995).
Miller et al.; Synthesis of Brome Masaic Virus Subgenomic RNA In Vitro by Internal Initiation on (-)-Sense Genomic RNA,Nature, 313:68-70 (Jan. 3, 1985).
Miller et al.; Luteovirus Gene Expression,Critical Reviews in Plant Sciences, 14(3):179-211 (1995).
Yutaka Eguchi

Affiliated with

Also associated with

Rating

Trans-activation of transcription from viral RNA does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Trans-activation of transcription from viral RNA, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Trans-activation of transcription from viral RNA will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-2895295