Promoter of the tomato expansin gene LeExp-1

Details Promoter of the tomato expansin gene LeExp-1 Promoter of the tomato expansin gene LeExp-1

2000-09-27

2002-01-22

Guzo, David (Department: 1635)

Organic compounds -- part of the class 532-570 series

Organic compounds

Carbohydrates or derivatives

C536S023100

Reexamination Certificate

active

06340748

ABSTRACT:

BACKGROUND OF THE INVENTION
1. Field of the Invention
The promoter of the tomato expansin gene LeExp-1 was cloned. The cDNA sequence for the tomato expansin LeExp-1 (Rose, et al., 1997) was used to design primers used in a method called inverse PCR to PCR the region upstream of the known cDNA sequence. This technique was utilized successfully to obtain the region that includes 566 base pairs upstream of the likely transcriptional start site. Also, PCR was employed to clone the remainder of the gene. The subject invention comprises the 581 bp promoter sequence (See FIG.
2
and SEQ ID NO: 1).
2. Description of the Background Art
The subject promoter, LeExp-
1
, normally directs expression of the tomato expansin LeExp-1 as reported in Rose et al. (this and all references cited in this disclosure are incorporated herein by reference). These authors isolated a cDNA clone and reported its sequence. Applicants used this reported sequence as a starting point to isolate a genomic clone using a PCR based approach. It is respectfully submitted that this information does not teach or render obvious applicant's claimed invention.
SUMMARY OF THE INVENTION
An object of the present invention is to disclose a promoter used to direct the expression of any gene to a high level.
Another object of the present invention is to present a promoter used to direct the expression of any gene to a high level, specifically in tomato fruit which is an excellent, cost-effective, large-scale expression system.
A further object of the present invention is to disclose a vector or DNA construct including the subject DNA sequence disclosed herein.
Still another object of the present invention is to relate a dicotyledonous plant cell or protoplast transformed with the subject DNA sequence disclosed herein.
Yet a further object of the present invention is to describe a method for enhancing gene expression comprising transforming cells or protoplasts with the subject DNA sequence and a heterologous coding sequence operably joined to the regulatory region, selecting the cells or protoplasts which have been transformed, regenerating the selected and transformed cells or protoplasts, and selecting organisms which express the heterologous gene.
Disclosed is a tomato promoter, LeExp-1, which is included in
FIG. 1 and
, in particular, shown in
FIG. 2
(also, see SEQ ID NO: 1). Among other attributes, the LeExp-1 promoter can direct a high level of fruit-specific expression. The LeExp-1 promoter can be fused to any DNA sequence (including, but not limited to, plant, animal, fungal, algal, and bacterial genes that encode proteins as well as DNA sequences that produce biologically active RNAs following transcription, including antisense RNAs and ribozymes) to direct a high level of transcription in tomato fruit.
More specifically, a primary subject goal was to isolate a promoter that could be utilized to drive a high level of expression of any gene in tomato fruit. To identify a promoter that would allow this the literature was examined for genes which had been shown to be expressed at high levels in tomato fruit and it was concluded that LeExp-1 is among the most highly expressed tomato fruit-specific genes identified to date (Rose et al., 1997). Since promoters are responsible for the control of gene expression the promoter of LeExp-1 was targeted for this invention since it would direct expression of any DNA sequence fused to it in the tomato fruit specific pattern observed for LeExp-1. The published LeExp-1 cDNA sequence represents a DNA copy of the LeExp-1 mRNA and so does not include the promoter for the LeExp-1 gene. Therefore, we set out to, and accomplished, the cloning of the LeExp-1 promoter. Prior to our cloning and DNA sequence analysis of the LeExp-1 promoter the sequence of the promoter of LeExp-1 was unknown.
In order to clone the promoter of the LeExp-1 gene we utilized a technique commonly referred to as inverse PCR® or IPCR (Ochman et al., 1993) which allows unknown regions of DNA to be cloned if an adjacent region is known. To accomplish this, we made use of the published sequence of the LeExp-1 cDNA (Rose, et al.,; Genbank Accession; U.S. Pat. No.:5,929,303).
The first step in the IPCR approach is to choose restriction enzymes that will cleave the genomic region of interest near the unknown region that is to be amplified by IPCR. To accomplish this for LeExp-1, the cDNA sequence was examined for restriction sites located near the 5′ end of the cDNA sequence. Since the DNA sequence of the upstream region was not known, it could not be determined without further experiments where the selected restriction enzymes would cut upstream. For success, inverse PCR requires the chance occurrence of a second site no further than approximately 6 kb upstream. If no sites for the selected enzyme occur within this distance, the strategy will not be successful. To increase the likelihood that a second site would occur within 6 kb upstream, an additional strategy was attempted here in which a second enzyme that generated compatible termini was used in a double digestion with the enzymes known to cut the cDNA insert. In this case, BcLI and BamHI were used in a double digestion.
In the next step, the digested genomic DNA was circularized by ligation with T4 DNA ligase. Circularization brings the two positions in the known sequence into juxtaposition with the unknown 5′ sequences. The known sequences then serve as oligonucleotide priming sites to amplify the 5′ unknown sequence. Following the first round of amplification, two nested primers were used to direct a second round of amplification.
The first pair of oligonucleotide primers were designed for inverse PCR in such a way that they annealed to the target DNA template 29 bp apart, and their 3′-termini were oriented in opposite directions. The oligonucleotide primers were designated LeExp-1-7 (5′GGAACAATGGGCGGTGCGTGTGG 3′)SEQ ID NO:3 and LeExp-1-8 rev. (5′GCATGTGCAGTTTCCCATGAACCACC 3′), SEQ ID NO:4 corresponding to the nucleotide sequences at 169-191 bp and 115-140 bp of the LeExp-1 cDNA, respectively. The two nested primers, designated LeExp-1-2 and LeExp-1-3 rev., were 5′ TTATACAGCCA AGGATACGG 3′(201-221) SEQ ID NO:5 and 5′ GTAAACACCAGGGATTCTTCC 3′(111-91) SEQ ID NO:6.
Inverse PCR was carried out with the two divergent primers, LeExp-1-7 and LeExp-1-8rev in a standard PCR reaction. Since the first PCR products were not visible on an agarose gel (data not shown), a second round of PCR was performed with the two nested primers, designated LeExp-1-2 and LeExp-1-3rev. A 1.4 kb PCR product was obtained from 500 ng of BcLI and BamHI digested and circularized tomato genomic DNA and subcloned into the vector pCR1000 (InVitrogen, Inc).
This clone was designated LeExp-1-1.4 and was sequenced in entirety on both strands. LeExp-1-1.4 consists of 581 bp of the 5′ region upstream of the LeExp-1 cDNA, 504 bp of exon 1, followed by a 343 bp intron, and 76 bp of the second exon. The regions of LeExp-1-1.4 that overlap the LeExp-1 cDNA are 99.9% identical to the published cDNA sequence (Rose, 1997) indicating that this region is the promoter for the LeExp-1 gene.
Other objects, advantages, and novel features of the present invention will become apparent from the detailed description that follows, when considered in conjunction with the associated drawings.


REFERENCES:
Rose, J. et al., 1997, Proc Natl. Acad. Sci. USA, vol. 94 (11), p. 5955-5960.*
Brummel, D. et al., 1999, Plant Mol. Biol., vol. 39 (1), p. 161-169.

Affiliated with

Also associated with

Rating

Promoter of the tomato expansin gene LeExp-1 does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Promoter of the tomato expansin gene LeExp-1, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Promoter of the tomato expansin gene LeExp-1 will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-2844621