Probe for detecting hepatitis C virus in tissues

Chemistry: molecular biology and microbiology – Measuring or testing process involving enzymes or... – Involving virus or bacteriophage

Patent

Rate now

  [ 0.00 ] – not rated yet Voters 0   Comments 0

Details

435 6, 435 912, C12Q 170, C12Q 168, C12P 1934

Patent

active

060964987

ABSTRACT:
A probe that is a labelled segment of RNA complementary to and capable of specifically hybridizing with denatured HCV RNA, and prepared from 5' sense, GGCGACACTCCACCATGAAT and 3' antisense, ccagagcatctggcacgtgg primers, from the 5' untranslated region of the HCV genome, is employed for detecting and identifying the presence of hepatitis C virus (HCV) in tissue.

REFERENCES:
patent: 5830635 (1998-11-01), Agnello
patent: 5846704 (1998-12-01), Maertens et al.
Han et al, Charaterization of the terminal region of Hepatitis C viral RNA: Identification of conserved sequences in the 5' untranslated region and poly(A) tails at the 3' end, Proc. Natl. Acad. Sci. Vol 88, pp 1711-1715, Mar. 1991, Biochemistry/.
Moldvay et al, Detection of Hepatitis C Virus RNA in Peripheral Blood Mononuclear Cells of Infected Patients by in Situ Hybridization, J. Am. Soc. Hemat., Vol 83, No. 1 (Jan. 1994) pp. 269-273.
Hu et al. Direct Detection of Circulating Hepatitis C Virus RNA Using Probes from the 5' Untranslated Region, J. Clin. Invest., vol. 89, Jun. 1992, pp. 2040-2045.
Lau et al, In Situ Detection of Heptits C virus--a critical appraisal--J. Hepat,,. 1996, Vol 24, (Supp 2) pp 43-51.
Nouri-Aria et al, Detection of Genomic and Intermediate Replicative Strands of Hepatitis C Virus in Liver Tissue by In Situ Hybridization, J. Clin. Invest. Vol 91, May 1993, pp. 2226-2234.
Negro et al. Detection of intrahepatic replication of hepatitis C virus RNA by in situ hybridization and comparison with histopathology, Proc. Natl Acad. Sci., vol. 89, Mar. 1992, pp. 2247-2251.
Arrand, Nucleic Acid Hybridization--a practical approach, ed, by Hames et al, IRL Press, Washington, D.C., 1985, pp. 42-45.
Lee et al, Identification of Hepatitis C Viruses with a Nonconserved Sequence in the 5' Untranslated Region J. Clin Microbiol., Vol 30, No. 6, Jun. 1992, pp. 1602-1604.
Bukh et al. Sequence analysis of the 5' noncoding region of hepatitis C virus, Proc. Natl. Acad. Sci Vol 89, pp 4942-4946 Jun. 1992, Biochemistry.

LandOfFree

Say what you really think

Search LandOfFree.com for the USA inventors and patents. Rate them and share your experience with other people.

Rating

Probe for detecting hepatitis C virus in tissues does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Probe for detecting hepatitis C virus in tissues, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Probe for detecting hepatitis C virus in tissues will most certainly appreciate the feedback.

Rate now

     

Profile ID: LFUS-PAI-O-662301

  Search
All data on this website is collected from public sources. Our data reflects the most accurate information available at the time of publication.