Presenilin-1 gene promoter

Details Presenilin-1 gene promoter Presenilin-1 gene promoter

1997-08-29

2001-07-03

Clark, Deborah J. R. (Department: 1633)

Organic compounds -- part of the class 532-570 series

Organic compounds

Carbohydrates or derivatives

C435S320100, C435S455000, C435S325000, C536S023100

Reexamination Certificate

active

06255473

ABSTRACT:

FIELD OF THE INVENTION
This invention relates to genomic Presinilin-1 gene constructs, and the regulatory regions thereof, and recombinant DNA constructs employing the same.
BACKGROUND OF THE INVENTION
Alzheimer's disease (AD) is a devastating neurological disorder and the most common cause of dementia. The genetics of this disorder suggest that multiple genes are involved. To date, mutations in four genes have been found to be associated with Alzheimer's disease phenotypes including the Amyloid Precursor Protein (APP) gene on chromosome 21 (Citron, M. et al.,
Nature
360, 672-674 (1992); Suzuki, N. et al.,
Science
264, 1336-1340 (1994)), the Apolipoprotein-E (APOE) gene on chromosome 19 (Corder, E. H. et al.,
Science
261, 921-923 (1993); Corder, E. H. et al.,
Nat. Genet.
7, 180-184 (1994); Strittmatter, W. J. et al.,
Proc. Natl. Acad. Sci. U.S.A.
90, 1977-81 (1993)), the Presenilin-1 (PS-1) gene on chromosome 14 (Sherrington, R. et al.,
Nature
375, 754-760 (1995)) and the Presenilin-2 (PS-2) gene on chromosome 1 (Levy-Lahad, E.et al.,
Science
269, 973-977 (1995)). An unknown gene on chromosome 12 appears to associate with a large percentage of late-onset AD patients (Stephanson, J.
J Am. Med. Asoc.
277, 775 (1997)). The majority of familial Alzheimer's disease cases are associated with mutations in the PS-1. To date, over 30 independent mutations in the PS-1 gene have been described in unrelated Alzheimer's families displaying an early-age-of-onset phenotype. Most of these mutations are missense mutations that result in single amino acid changes (Wasco, W. et al.,
Nat. med.
1, 848 (1995); Alzheimer's Disease Collaborative Group,
Nat. Genet.
11, 219-222 (1995); Campion, D. et al.,
Hum. Mol. Genet.
4, 2373-2377 (1995); Cruts, M.et al.,
Hum. Mol. Genet.
4, 2363-2371 (1995); Boteva, K. et al.,
Lancet
347, 130-131 (1996); Rossor, M. et al.,
Lancet
347, 1560 (1996); Kamino, K. et al.,
Neurosci. Let.
208, 195-198 (1996)).
Deletions found in Exons 4 and 9 cause additional mutations as do several truncations of the RNA transcripts arising by differential splicing (Perez-Tur, J. et al.,
Neuroreport.
7, 297-301 (1995).). Although clustering of these mutations within the protein suggests the location of functionally important domains, the exact function of Presenilin proteins is a matter of active investigation.
One approach to find gene function is to study the regulation of PS-1 gene expression. Using in situ hybridization, we and others demonstrate that PS-1 mRNA is most highly expressed in neurons of the brain (Koracs, D. M. et al.,
Nat. Med.
2, 224-229 (1996)). Immunohistochemistry revealed that the PS-1 protein was abundant in neurons, but was also associated with amyloid plaques and some glial cell types (Scheuner, D. et al.,
Nat. Med.
2, 864-870 (1996); Lah, J. et al.,
J. Neurosci.
17, 1971-1980 (1997)). In contrast, Sherrington et al. reported that PS-1 mRNA is widely expressed in a variety of organs throughout the body (
Nature
375, 754-760 (1995)). This raises the question as to why mutations in the PS-1 gene product appear to confer a disease state in familial Alzheimer's patients without apparent effect on their peripheral organs. The situation is further compounded because PS-1 mRNA and protein levels from FAD patients and age-matched healthy controls have not been reported, leaving open the possibility that aberrant regulation of PS-1 gene expression further contributes to the disease state.
Mutations in the PS-1 gene's promoter and non-protein encoding regions are not known and reports on the gene's wild-type sequence are lacking. Similarly, no functional analysis of the gene's ability to promote transcription have been reported. Combined with recent reports that PS-1 knockout mice are embryonic lethal ( Shen, J. et al.,
Cell
89, 629-639 (1997)), knowledge of the PS-1 gene sequence and its transcriptional regulation should be important clues that help to identify PS-1 function in both noon and diseased states.
SUMMARY OF THE INVENTION
We herein described a complete sequence of the mouse Presenilin-1 gene. This sequence has shown that there are two independent transcription start sites. Functional testing of the DNA regions surrounding these start sites showed that they both were apparently controlled by a single, major promoter that includes the +1 position of Exon 1A. This promoter was also quite interesting because it is mostly active in neuron-like cells. Further characterization can now progress to a complete description of those positive and negative DNA elements and transcription factors which function to control Presenilin-1 gene expression.
A first aspect of the present invention is, accordingly, an isolated DNA molecule that directs neuron-specific transcription of a downstream heterologous DNA segment in a mammalian cell, said isolated DNA molecule having a sequence selected from the group consisting of:
(a) the sequence spanning position −327 to position −206 of the mouse genomic Presenilin-1 gene (with position +1 indicating the transcription start site of exon 1A);
(b) the sequence spanning position −449 to position +1171 of the mouse genomic Presenilin-1 gene;
(c) the sequence spanning position −9 to position +16, of the mouse genomic Presenilin-1 gene (the sequence AGGCCGGAAGTTGCGACACCGGTGA (SEQ ID NO:1)); and
(d) DNA sequences that hybridize to isolated DNA having a sequence of (a), (b), or (c) above, and which direct neuron specific transcription of a downstream heterologous DNA segment in a mammalian cell.
By “neuron specific” is meant any level of specificity, so long as the downstream heterologous DNA is preferentially transcribed or expressed in a neuron. By “neuron” is meant an excitable cell that sends a signal, as is well known in the art (e.g., neurons of the brain cortex).
A second aspect of the present invention is a DNA constrict comprising an expression cassette, which contains, in the 5′ to 3′ direction, a promoter segment consisting of a DNA sequence as given above, and a heterologous DNA segment positioned downstream from said promoter segment and operatively associated therewith.
A third aspect of the present invention is a nerve cell containing a DNA construct as described above.
A fourth aspect of the present invention is a method of making a transgenic non-human animal. The method comprises transforming an animal cell with an expression cassette as described above, and then regenerating an animal from the transformed animal cell.
A fifth aspect of the present invention is a transgenic non-human animal, wherein some or all of the cells of the animal containing a heterologous expression cassette as described above.
The foregoing and other objects and aspects of the present invention are explained in detail in the drawings herein and the specification set forth below.


REFERENCES:
Sorbi, S., et al. Missense Mutation of S182 Gene in Italian Families with Early-Onset Alzheimer's Disease,The Lancet, vol. 346, pp. 439-440 (Aug. 12, 1995).
Rogaev, et al., Analysis of the 5′Sequence, Genomic Structure, and Alternative Splicing of the presenilin-1 Gene (PSEN1) Associated with Early Onset Alzheimer Disease,Genomics, vol. 40, pp. 415-424 (1997).
Tsuda, T., et al. Failure to detect missense mutations in the S182 gene in a series of late-onset Alzheimer's disease cases,Neuroscience Letters, vol. 201, pp. 188-190 (1995).
Sherrington, R., et al., Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease,Nature, vol. 375, pp. 754-760 (Jun. 29, 1995).
Sherrington, R., et al., Alzheimer's disease associated with mutations in presenilin 2 is rare and variably penetrant,Human Molecular Genetics, vol. 5, No. 7, pp. 958-988 (1996).
Rogaev, et al., Familial Alzheimer's disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer's disease type 3 gene,Nature, vol. 376, pp. 775-778 (Aug. 31, 1995).
PCT/US98/17905 Internati

Affiliated with

Also associated with

Rating

Presenilin-1 gene promoter does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Presenilin-1 gene promoter, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Presenilin-1 gene promoter will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-2535257