Chemistry: natural resins or derivatives; peptides or proteins; – Proteins – i.e. – more than 100 amino acid residues – Blood proteins or globulins – e.g. – proteoglycans – platelet...
Reexamination Certificate
2006-06-29
2010-12-21
Mosher, Mary E (Department: 1648)
Chemistry: natural resins or derivatives; peptides or proteins;
Proteins, i.e., more than 100 amino acid residues
Blood proteins or globulins, e.g., proteoglycans, platelet...
C530S389400, C530S388300, C435S005000
Reexamination Certificate
active
07855277
ABSTRACT:
A new group of picornaviruses is disclosed. The picornaviruses of the invention comprise in the non-coding region of their viral genome a nucleotide sequence which corresponds to cDNA sequence (I) or homologous sequences having at least 75% homology to the SEQ ID NO:1, and they cause mammalian disease. Further aspects of the invention comprise a protein corresponding to a protein of the picornaviruses, antiserum or antibody directed against a protein of the picornaviruses, antigen comprising a protein of the picornaviruses, diagnostic kits, vaccines, use of the picornaviruses in medicaments, particularly for the treatment or prevention of Myocarditis, Cardiomyopathia, Guillain Barré Syndrome, and Diabetes Mellitus, Multiple Sclerosis, Chronic Fatigue Syndrome, Myasthenia Gravis, Amyothrophic Lateral Sclerosis, Dermatomyositis, Polymyositis, Spontaneous Abortion, and Sudden Infant Death Syndrome, and methods of treatment of diseases caused by the picornaviruses.SEQ ID NO: 1 (Ljungan 87-012)(I)AGTCTAGTCT TATCTTGTAT GTGTCCTGCA CTGAACTTGTTTCTGTCTCT 50GGAGTGCTCT ACACTTCAGT AGGGGCTGTA CCCGGGCGGTCCCACTCTTC 100ACAGGAATCT GCACAGGTGG CTTTCACCTC TGGACAGTGCATTCCACACC 150CGCTCCACGG TAGAAGATGA TGTGTGTCTT TGCTTOTGAAAAGCTTGTGA 200AAATCGTGTG TAGGCGTAGC GGCTACTTGA GTGCCAGCGO ATTACCCCTA 250GTGGTAACAC TAGC
REFERENCES:
patent: 7101554 (2006-09-01), Niklasson
Ryan et al. Journal of General Virology, 1990, vol. 71, pp. 2291-2299.
Lloyd et al. Journal of Virology, Nov. 1988, vol. 62, No. 11, pp. 4216-4223.
Apodemus AB
Kohn & Associates PLLC
Mosher Mary E
LandOfFree
Picornaviruses, vaccines and diagnostic kits does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Picornaviruses, vaccines and diagnostic kits, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Picornaviruses, vaccines and diagnostic kits will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-4151431