Picornaviruses, vaccines and diagnostic kits

Details Picornaviruses, vaccines and diagnostic kits Picornaviruses, vaccines and diagnostic kits

2006-09-05

2006-09-05

Mosher, Mary E. (Department: 1648)

Drug, bio-affecting and body treating compositions

Antigen, epitope, or other immunospecific immunoeffector

Amino acid sequence disclosed in whole or in part; or...

C424S216100, C435S235100, C435S005000, C530S300000, C530S350000, C530S387900, C530S388300, C530S389400

Reexamination Certificate

active

07101554

ABSTRACT:
A new group of picornaviruses is disclosed. The picornaviruses of the invention comprise in the non-coding region of their viral genome a nucleotide sequence which corresponds to cDNA sequence (I) or homologous sequences having at least 75% homology to the SEQ ID NO:1, and they cause mammalian disease. Further aspects of the invention comprise a protein corresponding to a protein of the picornaviruses, antiserum or antibody directed against a protein of the picornaviruses, antigen comprising a protein of the picornaviruses, diagnostic kits, vaccines, use of the picornaviruses in medicaments, particularly for the treatment or prevention of Myocarditis, Cardiomyopathia, Guillain Barré Syndrome, and Diabetes Mellitus, Multiple Sclerosis, Chronic Fatique Syndrome, Myasthenia Gravis, Amyothrophic Lateral Sclerosis, Dermatomyositis, Polymyositis, Spontaneous Abortion, and Sudden Infant Death Syndrome, and methods of treatment of diseases caused by the picornaviruses.SEQ ID NO: 1 (Ljungan 87–012)(I)AGTCTAGTCT TATCTTGTAT GTGTCCTGCA CTGAACTTGT50TTCTGTCTCTGGAGTGCTCT ACACTTCAGT AGGGGCTGTA CCCGGGCGGT100CCCACTCTTCACAGGAATCT GCACAGGTGG CTTTCACCTC TGGACAGTGC150ATTCCACACCCGCTCCACGG TAGAAGATGA TGTGTGTCTT TGCTTGTGAA200AAGCTTGTGAAAATCGTGTG TAGGCGTAGC GGCTACTTGA GTGCCAGCGG250ATTACCCCTAGTGGTAACAC TAGC

REFERENCES:
patent: 5229111 (1993-07-01), Palmenberg et al.
Niklasson et al., A New Picornavirus Isolated from Bank Voles (Clethrionomys glareolus). Virology 255:86-93, 1999.
Rueckert, Roland R. Picorrnaviridae: the viruses and their replication. Fields Virology, 3rdedition, ed. B.N. Fields et al, Lippincott-Raven Publishers, Philadelphia, 1996, pp. 609-654.
Melnick, Joseph L. Enteroviruses: polioviruses, coxsackieviruses, echoviruses, and newer enteroviruses. Fields Virology, 3rd edition, ed. B.N. Fields et al, Lippincott-Raven Publishers, Philadelphia, 1996, pp. 655-712.
Hypia et al. Proceedings of the National Academy of Sciences USA 89:8847-8851, 1992.
AAM46801 (Genbank AF327922.1) [online][retrieved Jan. 14, 2005] Retrieved from NCBI Entrez Protein, from the Internet <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi!db=protein&val=21309880>.
Johansson et al (Journal of Virology 76:8920-2930, 2002).
Lindberg et al (Virus Research 85:61-70, 2002).
Hughes (Infection, Genetics, and Evolution 4:143-152, 2004, abstract only cited).
Hyypiä et al., Proc. Natl. Acad. Sci., 89: 8847-8851 (1992).
Jun et al., Journal of General Virology, 76: 2557-2566 (1995).
Dan et al., Exp. Anim., 44(3): 211-218 (1995).
Tolbert et al., Proc. Soc. Exp. Biol. Med., 205(2): 124 (1994).
Dialog Information Services, file 34, SciSearch, Dialog accession No. 14364904.
Dialog Information Services, file 154, MEDLINE, Dialog accession No. 08478765.
Dialog Information Services, file 154, MEDLINE, Dialog accession No. 08518839.
Dialog Information Services, file 154, MEDLINE, Dialog accession No. 06649814.
Dialog Information Services, file 34, SciSearch, Dialog accession No. 14364904, 1995.
Dialog Information Services, file 154, MEDLINE, Dialog accession No. 08478765, 1994
Dialog Information Services, file 154, MEDLINE, Dialog accession No. 08518839, 1995
Dialog Information Services, file 154, MEDLINE, Dialog accession No. 06649814, 1990.

Affiliated with

Also associated with

Rating

Picornaviruses, vaccines and diagnostic kits does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Picornaviruses, vaccines and diagnostic kits, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Picornaviruses, vaccines and diagnostic kits will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-3551840