Organic compounds -- part of the class 532-570 series – Organic compounds – Carbohydrates or derivatives
Reexamination Certificate
2001-07-05
2004-08-03
McGarry, Sean (Department: 1635)
Organic compounds -- part of the class 532-570 series
Organic compounds
Carbohydrates or derivatives
C514S04400A, C435S006120, C435S325000, C435S375000, C536S023100
Reexamination Certificate
active
06770753
ABSTRACT:
BACKGROUND OF THE INVENTION
Heparanase
Cancer is the second leading cause of death in the United States. When cancer has metastasized, it can only be cured by systemic therapy, usually cytotoxic chemotherapy. Alternative methods to prevent tumor spread that would avoid cytotoxic chemotherapy are very desirable.
One area of promise in alternative methods of therapy involves the study of heparanase. Heparanase breaks down heparan—a component of the cell surface and extracellular matrix. It has recently been shown that inhibition of heparanase reduces tumor spread (Kussie, et al. 1999 and Vlodasky, 1999), reducing both tumor neogenesis and angiogenesis.
Antisense Phosphorothioate Oligonucleotides
One way to achieve therapeutically useful targeted inhibition of protein expression is likely going to be through the use of antisense oligonucleotides. Antisense oligonucleotides are small fragments of DNA complementary to a defined sequence on a specified mRNA. The antisense oligonucleotide specifically binds to targets on the mRNA molecule and in doing so inhibits the translation of a specific mRNA into protein.
Antisense oligonucleotide molecules synthesized with a phosphorothioate backbone have proven particularly resistant to exonuclease damage compared to standard deoxyribonucleic acids, and so they are used in preference.
The present study discloses that instead of inhibiting heparanase itself, another method to reduce tumor spread may be to inhibit heparanase protein expression using antisense phosphorothioate oligonucleotides.
SUMMARY OF INVENTION
This invention provides an oligonucleotide having a sequence complementary to a sequence of a ribonucleic acid encoding a heparanase, wherein:
(a) the oligonucleotide hybridizes with the ribonucleic acid under conditions of high stringency and is between 10 and 40 nucleotides in length;
(b) the internucleoside linkages of the oligonucleotide comprise at least one phosphorothioate linkage; and
(c) hybridization of the oligonucleotide to the ribonucleic acid inhibits expression of the heparanase, wherein inhibition of heparanase expression means at least a 50% reduction in the quantity of heparanase as follows: (a) a T24 bladder carcinoma cell is exposed to a complex of the oligonucleotide and lipofectin at an oligonucleotide concentration of 1 &mgr;M and a lipofectin concentration of 10 &mgr;g/ml for 5 hours at 37° C., (b) the complex is completely removed after such exposure, (c) 19 hours later the cell is scraped, washed and extracted in lysis buffer, (d) the nucleus of the cell is removed by centrifugation, (e) the cytoplasmic proteins in the resulting supernatant are separated according to mass by sodium dodecyl sulphate polyacrylamide gel electrophoresis, (f) the protein is transferred to a polyvinylidene difluoride membrane that is incubated at room temperature for 1-2 hours in incubation solution (g) the membrane is exposed to 1 &mgr;g/ml of an antibody directed against heparanase at 4° C. for 12 hours, (h) the membrane is exposed to wash buffer and incubated for 1 hour at room temperature in blocking buffer comprising a 1:3,000 dilution of a peroxidase-conjugated secondary antibody directed against an epitope on the antibody directed against heparanase, (i) the membrane is exposed to a chemiluminescent cyclic diacylthydrazide and the oxidation of the cyclic diacylthydrazide by the peroxidase is detected as a chemiluminescent signal, and (j) the signal is quantitated by laser-scanning densitometry as a measure of the amount of heparanase expressed calculated as a percentage of heparanase expression in an untreated cell.
This invention further provides the instant oligonucleotide, wherein the oligonucleotide comprises deoxyribonucleotides.
This invention further provides the instant oligonucleotide, wherein the oligonucleotide comprises ribonucleotides.
This invention further provides the instant oligonucleotide, wherein every internucleoside linkage is a phosphorothioate linkage.
This invention further provides the instant oligonucleotide, wherein the oligonucleotide is between 15 and 25 nucleotides in length.
This invention further provides the instant oligonucleotide, wherein the oligonucleotide is about 20 nucleotides in length.
This invention further provides the instant oligonucleotide, wherein the sequence of the oligonucleotide is selected from the following:
(a) CCCCAGGAGCAGCAGCAGCA (SEQ ID NO: 3);
(b) GTCCAGGAGCAACTGAGCAT (SEQ ID NO: 4); and
(c) AGGTGGACTTTCTTAGAAGT (SEQ ID NO: 5).
This invention further provides the instant oligonucleotide, wherein the oligonucleotide further comprises a modified internucleoside linkage.
This invention further provides the instant oligonucleotide, wherein the modified internucleoside linkage is a peptide-nucleic acid linkage, a morpholino linkage, a phosphodiester linkage or a stereo-regular phosphorothioate.
This invention further provides the instant oligonucleotide, wherein the oligonucleotide further comprises a modified sugar moiety.
This invention further provides the instant oligonucleotide, wherein the modified sugar moiety is 2′-O-alkyl oligoribonucleotide.
This invention further provides the instant oligonucleotide, wherein the oligonucleotide further comprises a modified nucleobase.
This invention further provides the instant oligonucleotide, wherein the modified nucleobase is a 5-methyl pyrimidine or a 5-propynyl pyrimidine.
This invention further provides the instant oligonucleotide, wherein the heparanase is a human heparanase.
This invention also provides a method of inhibiting expression of a heparanase in a cell comprising contacting the cell with the instant oligonucleotide under conditions such that the oligonucleotide hybridizes with mRNA encoding the heparanase so as to thereby inhibit the expression of the heparanase.
This invention further provides the instant method, wherein the cell is a cancer cell.
This invention also provides a composition comprising the instant oligonucleotide in an amount effective to inhibit expression of a heparanase in a cell and a carrier.
This invention further provides the instant composition, wherein the oligonucleotide and the carrier are capable of passing through a cell membrane.
This invention further provides the instant composition, wherein the carrier comprises a membrane-permeable cationic reagent.
This invention further provides the instant composition, wherein the cationic reagent is lipofectin.
This invention also provides a method of treating a tumor in a subject which comprises administering to the subject an amount of the instant oligonucleotide effective to inhibit expression of a heparanase in the subject and thereby treat the tumor.
This invention further provides the instant method, wherein the subject is a human being.
This invention further provides the instant method, wherein the treatment of the tumor is effected by reducing tumor growth.
This invention further provides the instant method, wherein the treatment of the tumor is effected by reducing tumor metastasis.
This invention further provides the instant method, wherein the treatment of the tumor is effected by reducing angiogenes is.
This invention also provides a method of treating a subject which comprises administering to the subject an amount of the instant oligonucleotide effective to inhibit expression of a heparanase in the subject and thereby treat the subject.
This invention further provides the instant method, wherein the subject is a human being.
This invention also provides the use of the instant oligonucleotide for the preparation of a pharmaceutical composition for treating a tumor in a subject which comprises admixing the oligonucleotide in an amount effective to inhibit expression of a heparanase in the subject, with a pharmaceutical carrier.
This invention also provides an oligonucleotide having a sequence complementary to a sequence of a ribonucleic acid encoding a heparanase, wherein:
(a) the oligonucleotide hybridizes with the ribonucleic acid under conditions of high stringency and is between 10 and 40 nucleotides in length;
(b)
Cooper & Dunham LLP
McGarry Sean
Schultz James Douglas
The Trustees of Columbia University in the City of New York
White John P.
LandOfFree
Phosphorothioate antisense heparanase oligonucleotides does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Phosphorothioate antisense heparanase oligonucleotides, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Phosphorothioate antisense heparanase oligonucleotides will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-3317244