Organic compounds -- part of the class 532-570 series – Organic compounds – Carbohydrates or derivatives
Reexamination Certificate
1997-06-24
2001-08-21
Ulm, John (Department: 1646)
Organic compounds -- part of the class 532-570 series
Organic compounds
Carbohydrates or derivatives
C435S069100, C435S252300, C435S320100
Reexamination Certificate
active
06277976
ABSTRACT:
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to cellular nuclear receptors.
2. Brief Description of the Art
A large family of nuclear receptors has been identified which confer cells with responsiveness to molecules such as retinoic acid, vitamin D3, steroid hormones and thyroid hormones. Extensive studies have shown that the members of this superfamily of nuclear receptors activate and/or repress gene transcription through direct binding to discrete cis-acting elements termed “hormone response elements” (HRE). It has been shown that these HRE's comprise repeats of consensus palindromic hexanucleotide DNA motifs. The specificity of the HRE's is determined by the orientation of, and spacing between, halfsites (i.e. half a palindromic sequence)(Umenesono K., et al, 1991
Cell
65, 1255-1266).
Specific DNA binding is mediated by a distinct DNA binding domain, containing two zinc fingers, which is conserved among all thus discovered nuclear receptors. Three amino acids at the C-terminal base of the first zinc finger (known as the “P-box”) are important for the recognition of the half site nucleotide sequence. Members of the nuclear receptor superfamily have been classified into different groups on the basis of the amino acid sequence within the P box.
Molecules thought to be nuclear receptors, as they are structurally related to characterized receptors, but for which no ligand has been identified are termed “orphan receptors”. Many such orphan receptors have been identified (see for example Evans R. M, (1988)
Science
240,889-895 and O'Malley, B. (1990)
Mol. Endocrinol.
4 363-369).
BRIEF SUMMARY OF THE INVENTION
According to one aspect of the invention there is provided a novel nuclear receptor, hereinafter termed “OR-
1
”, having the amino acid sequence of
FIG. 1
(SEQ ID NO:2) or substantially the same amino acid sequence as the amino acid sequence shown in
FIG. 1
(SEQ ID NO:2) or an amino acid sequence functionally similar to that sequence.
An amino acid sequence which is more than about 90%, preferably more than 95%, identical with the sequence shown in
FIG. 1
(SEQ ID NO:2) is substantially the same amino acid sequence for the purposes of the present application.
According to another aspect of the invention there is provided a DNA sequence encoding a nuclear receptor according to the first aspect of the invention. Preferably, the DNA sequence is that given in
FIG. 2
(SEQ ID NO:1) or is a DNA sequence encoding a protein or polypeptide having the functionality of OR-
1
.
The nuclear receptor of the invention has a similar P-box configuration to the retinoic acid receptor (RAR), the vitamin D receptor (VDR), and the thyroid hormone receptor (TR) and can be placed in the same subfamily as those receptors.
Preferably, the receptor heterodimerizes with RXR to form a complex.
Preferably, the receptor interacts with RXR and binds to a DNA sequence comprising at least one repeat of the DNA sequence -AGGTCA- (SEQ ID NO:10). Preferably the sequence is AGTCAGGTCACTCGAGGTCAGTCA (SEQ ID NO:11).
Preferably, the receptor modulates 9-cis retinoic acid signalling.
REFERENCES:
patent: 5639616 (1997-06-01), Liao et al.
patent: 9306215 (1993-04-01), None
George et al., Macromolecular Sequencing and Synthesis, Selected Methods and applications, 127-149, 1988, Alan R. Liss, Inc., 1988.*
Ayala et al., Modern Genetics, 45-48, 1980, Benjamin/Cummings Publishing Company Inc., Menlo Park, California.
Enmark Eva L. K.
Gustafsson Jan-Ake
Garabedian Todd E.
Karo Bio AB
Ulm John
LandOfFree
Or-1, an orphan receptor belonging to the nuclear receptor... does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Or-1, an orphan receptor belonging to the nuclear receptor..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Or-1, an orphan receptor belonging to the nuclear receptor... will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-2518704