Chemistry: molecular biology and microbiology – Micro-organism – tissue cell culture or enzyme using process... – Preparing compound containing saccharide radical
Reexamination Certificate
1999-12-17
2002-12-10
Martinell, James (Department: 1633)
Chemistry: molecular biology and microbiology
Micro-organism, tissue cell culture or enzyme using process...
Preparing compound containing saccharide radical
C435S091210, C536S024300
Reexamination Certificate
active
06492143
ABSTRACT:
FIELD OF THE INVENTION
This invention generally pertains to the fields of cell biology and medicine. In particular, this invention provides novel libraries of nucleic acids encoding odorant/ligand-binding domains. Also provided are libraries of hybrid 7-transmembrane olfactory receptors comprising these odorant ligand-binding domains. The compositions and methods of the invention can be used to identify novel ligand-binding domains for olfactory neuron odorant receptors and their ligands. Thus, the compositions and methods of the invention can be used to generate novel odorants and to manipulate an animal's olfactory response.
BACKGROUND OF THE INVENTION
A better understanding of the vertebrate olfactory system would provide improved means to manipulate this process and possibly prevent disease or injury. For example, means to manipulate human olfactory neuron odorant receptors from healthy individuals and from individuals with neuro-psychiatric illnesses would offer systems for testing possible odorant/ligands for therapeutic and toxic effects. However, our ability to detect and discriminate between the thousands of beneficial or toxic odorants is complicated by the fact that odorant receptors belong to a multigene family with at least 500 to 1000 members. Furthermore, each olfactory receptor neuron may express only one, or at most a few, of these olfactory receptors. Any given olfactory neuron cell can respond to a small, arbitrary set of odorant-ligands. Odorant discrimination for a given neuron may depend on the ligand specificity of the one or few receptors it expresses. Thus, given this systems' complexity, information about odorant/ligand-receptor recognition remains meager.
To analyze odorant/ligand-receptor interactions and their effects on cell physiology, it is first necessary to identify specific odorant/ligand(s) and the olfactory receptors to which they specifically bind. Such analysis requires isolation and expression of olfactory receptor polypeptides. However, despite the fact that many putative olfactory receptors have been cloned, only limited progress has been made in the functional expression of these receptors because present systems fail to efficiently translocate these 7-transmembrane proteins to the plasma membrane. This may be because olfactory receptors are a subclass of 7-transmembrane-domain receptors. For example, expression of one rat olfactory receptor in insect cells resulted in only a modest elevation in second messengers when exposed to a mixture of odorants; responses to single compounds were not seen (Raming (1993) Nature 361:353-356). The present invention addresses these and other needs.
SUMMARY OF THE INVENTION
The present invention provides novel compositions and methods to generate great numbers, or libraries, of odorant receptor ligand-binding regions. Also provided are novel chimeric olfactory receptors that incorporate these libraries of odorant binding domains. The present invention also provides novel compositions and methods to efficiently translocate polypeptides to the plasma membrane surface. Another aspect of the invention is based on the surprising discovery of a peptide domain that, when incorporated into a polypeptide, can with great efficiency “chaperone” or translocate the hybrid protein to the cell plasma membrane. Combining these two aspects of the invention also provides expression vectors and cells that efficiently express these recombinant proteins. Cells and transgenic animals efficiently expressing libraries of hybrid olfactory receptors can be used for screening potential beneficial and toxic odorant molecules.
The invention provides an amplification primer sequence pair for amplifying a nucleic acid encoding an olfactory receptor ligand-binding region comprising a first primer comprising a sequence 5′-GGGGTCCGGAG(A/G)(C/G)(A/G)TA(A/G/T)AT(A/G/P)A(A/G/P)(A/G/P)GG-3′ (SEQ ID NO:1) and a second primer comprising a sequence 5′-GGGGCTGCAGACACC(A/C/G/T)ATGTA(C/T)(C/T)T(A/C/G/T)TT(C/T)(C/T)T-3′ (SEQ ID NO:2). When used to amplify olfactory receptor nucleic acid sequences, it typically amplifies the receptor ligand-binding region comprising olfactory receptor transmembrane (TM) domains II through VII.
The invention also provides a method for generating nucleic acid sequence that encodes a ligand-binding region of an olfactory receptor, the method comprising amplification of a nucleic acid using the primer pair SEQ ID NO:1 and SEQ ID NO:2. In this method the amplified nucleic acid can be genomic DNA, mRNA or cDNA derived from olfactory neurons or olfactory epithelium. The amplification can be by polymerase chain reaction (PCR), wherein the PCR amplification comprises the following conditions and steps in the following order: about one cycle at about 94° C. for about 2 min; and about 30 cycles of about 45° C. to about 65° C. for about 1 min, followed by about 72° C. for about one min. followed by about 94° C. for about 1 min. The PCR amplification protocol can further comprise the following conditions and steps in the following order: about one cycle of about 45° C. to about 65° C. for about 10 min; and about one cycle of about 72° C. for about 10 min.
Also provides is a kit for amplification of olfactory receptor sequences comprising primer pairs that can amplify olfactory receptor transmembrane domain regions II through VII, II through VI, III through VII, or III through VI, e.g., SEQ ID NO:1 and SEQ ID NO:2 to amplify TM II through VII.
The invention also provides a library of olfactory receptor ligand-binding regions consisting essentially of olfactory receptor transmembrane domain regions II through VII, II through VI, III through VII, or III through VI, including partial domains, or a combination of domain sequences. The library of the olfactory receptor ligand-binding regions can be generated by PCR using degenerate primer pairs.
Also provided is a library of chimeric nucleic acid sequences comprising the following domains in 5′ to 3′ order: a nucleic acid encoding an amino terminal plasma membrane translocation domain; a nucleic acid encoding a first transmembrane domain; and a nucleic acid encoding an olfactory receptor ligand-binding region, wherein the chimeric nucleic acid sequence encodes a 7-transmembrane polypeptide that can transverse a plasma membrane seven times. The amino terminal plasma membrane translocation domain comprises an amino acid sequence as set forth in SEQ ID NO:3 (and encoded by a subsequence of SEQ ID NO:6):
5′-GGATCCGGGTTCGCGCCGCCGGCGGGCAGCCGCAAGGGCCGCAGCCATGAACGGGACCGAGGGC
M N G T E G
CCAAACTTCTACGTGCCTTTCTCCAACAAGACGGGCGTGGTGGAATTC-3′
(SEQ ID NO:6)
P N F Y V P F S N K T G V V
(SEQ ID NO:3)
In alternative embodiments, the nucleic acid encoding the first transmembrane domain can be just a polynucleotide sequence encoding SEQ ID NO:3, or, SEQ ID NO:6 (including 45 nucleotides upstream of the initiation codon) or a subsequence thereof.
The first transmembrane receptor of the sequences of the library can be a 7-transmembrane receptor region I domain, or subsequence thereof, e.g., the sequence between the Eco R1 and Pst 1 sites of the M4-chimeric olfactory receptor of the invention (SEQ ID NO:4), as schematically represented in
FIG. 1A
; the full length sequence of the hybrid receptor has an amino acid sequence as set forth in SEQ ID NO:55, a nucleic acid that can encode this protein is SEQ ID NO:54, described below.
The olfactory receptor ligand-binding regions of the li
Krautwurst Dietmar
Reed Randall R.
Yau King-Wai
Banner & Witcoff , Ltd.
Martinell James
The John Hopkins University
LandOfFree
Olfactory receptor expression libraries and methods of... does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Olfactory receptor expression libraries and methods of..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Olfactory receptor expression libraries and methods of... will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-2976624