Nuclear retinoic acid co-receptor

Details Nuclear retinoic acid co-receptor Nuclear retinoic acid co-receptor

2001-07-19

2003-02-25

Ulm, John (Department: 1646)

Organic compounds -- part of the class 532-570 series

Organic compounds

Carbohydrates or derivatives

C435S069100, C435S252300, C435S320100

Reexamination Certificate

active

06525188

ABSTRACT:

BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to cellular nuclear receptors.
2. Brief Description of the Art
A large family of nuclear receptors has been identified which confer cells with responsiveness to molecules such as retinoic acid, vitamin D3, steroid hormones and thyroid hormones. Extensive studies have shown that the members of this superfamily of nuclear receptors activate and/or repress gene transcription through direct binding to discrete cis- acting elements termed “hormone response elements” (HRE). It has been shown that these HRE's comprise repeats of consensus palindromic hexanucleotide DNA motifs. The specificity of the HRE's is determined by the orientation of, and spacing between, halfsites (i.e. half a palindromic sequence)(Umenesono K., et al, 1991
Cell
65, 1255-1266).
Specific DNA binding is mediated by a distinct DNA binding domain, containing two zinc fingers, which is conserved among all thus discovered nuclear receptors. three amino acids at the C-terminal base of the first zinc finger (known as the “P-box”) are important for the recognition of the half site nucleotide sequence. Members of the nuclear receptor superfamily have been classified into different groups on the basis of an amino acid sequence within the P box.
Molecules thought to be nuclear receptors, as they are structurally related to characterized receptors, but for which no ligand has been identified are termed “orphan receptors”. Many such orphan receptors have been identified (see for example Evans R. M, (1988)
Science
240,889-895 and O'Malley, B. (1990)
Mol. Endocrinol.
4 363-369).
BRIEF SUMMARY OF THE INVENTION
According to one aspect of the invention there is provided a novel nuclear receptor, hereinafter terms “OR-1”, having the amino acid sequence of
FIG. 1
(SEQ ID NO:2) or substantially the same amino acid sequence as the amino acid sequence shown in
FIG. 1
(SEQ ID NO:2) or an amino acid sequence functionally similar to that sequence.
An amino acid sequence which is more than about 90%, preferably more than 95%, identical with the sequence shown in
FIG. 1
(SEQ ID NO:2) is substantially the same amino acid sequence for the purposes of the present application.
According to another aspect of the invention there is provided a DNA sequence encoding a nuclear receptor according to the first aspect of the invention. Preferably, the DNA sequence is that given in
FIG. 2
(SEQ ID NO:1) or is a DNA sequence encoding a protein or polypeptide having the functionality of OR-1.
The nuclear receptor of the invention has a similar P-box configuration to the retinoic acid receptor (RAR), the vitamin D receptor (VDR), and the thyroid hormone receptor (TR) and can be placed in the same subfamily as those receptors.
Preferably, the receptor heterodimerizes with RXR to form a complex.
Preferably, the receptor interacts with RXR and binds to a DNA sequence comprising at least one repeat of the DNA sequence AGGTCA (SEQ ID NO:10. Preferably the sequence is AGTCAGGTCACTCGAGGTCAGTCA (SEQ ID NO:11)
Preferably, the receptor modulates 9-cis retinoic acid signalling.


REFERENCES:
patent: 5639616 (1997-06-01), Liao et al.
patent: 93-06215 (1993-04-01), None
patent: 95-13373 (1995-05-01), None
Ayala et al., Modern Genetics, 45-48, 1980 Benjamin/Cummings Publishing Company Inc., Menlo Park, California.
George et al., Macromolecular Sequencing and Synthesis, Selected Methods and applications, 127-149, 1988, Alan R. Liss, Inc.
Song, Ching; Characterization Of A Unbiquitous Receptor, A New Member Of The Nuclear Receptor Superfamily; University of Chicago;(1994) Diss. Abstract. Int. B., 1994; 55(3), 734.
Tebol, M. et al., “OR-1, A Member Of The Nuclear Receptor Superfamily That Interacts With The 9-Cis-Retinoic Acid Receptor” Proc. Natl. Acad. Sci. USA 92:2096-2100 (Mar. 14, 1995).

Affiliated with

Also associated with

Rating

Nuclear retinoic acid co-receptor does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Nuclear retinoic acid co-receptor, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Nuclear retinoic acid co-receptor will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-3178466