Chemistry: molecular biology and microbiology – Micro-organism – tissue cell culture or enzyme using process... – Recombinant dna technique included in method of making a...
Patent
1994-07-27
1998-01-13
Guzo, David
Chemistry: molecular biology and microbiology
Micro-organism, tissue cell culture or enzyme using process...
Recombinant dna technique included in method of making a...
4352542, 43525423, 4353201, 536 241, C12P 2102, C12N 1509, C12N 1567, C07H 2104
Patent
active
057078270
ABSTRACT:
A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying the promoter, a transformant into which the vector has been introduced and a method for producing a heterologous protein, comprising culture of the transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.
Hiramatsu Ryuji
Miura Masami
Ohi Hideyuki
Ohmura Takao
Degen Nancy T.
Guzo David
The Green Cross Corporation
LandOfFree
Mutant AOX2 promoter, vector carrying same, transformant and pro does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Mutant AOX2 promoter, vector carrying same, transformant and pro, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Mutant AOX2 promoter, vector carrying same, transformant and pro will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-325391