Methods of making cytoplasmic male sterile chicory plants...

Details Methods of making cytoplasmic male sterile chicory plants... Methods of making cytoplasmic male sterile chicory plants...

1998-11-30

2004-10-12

Kruse, David H (Department: 1638)

Multicellular living organisms and unmodified parts thereof and

Method of using a plant or plant part in a breeding process...

Method of breeding involving a genotypic or phenotypic marker

C435S430000, C800S268000, C800S269000, C800S274000

Reexamination Certificate

active

06803497

ABSTRACT:

The present invention relates to the use of nucleotide sequences which allows cytoplasmic-type male sterility to be imparted to plants of the genus Cichorium.
The genus Cichorium includes plants which are of great interest in the agrifood industry, such as the various types of chicory and endives.
These are plants which have male and female reproduction systems at the same time and are therefore capable of self-fertilization. Such an event is undesirable when it is desired to carry out crosses with a plant of another variety in order to obtain hybrids.
In
Cichorium intybus
, plants which exhibit nuclear male sterility have already been proposed. However, cytoplasmic male sterility is an interesting solution for the production of hybrid species.
Cytoplasmic male sterility is a characteristic that is transmitted by the female parent of a plant (maternal inheritance) and which prevents the formation of viable pollen. Good-quality male sterility must not affect female fertility of the plant to allow it to be crossed with male fertile plants. It is therefore desirable to have available a system which imparts such stable cytoplasmic male sterility.
It is also desirable to have available a reliable marker of this cytoplasmic male sterility which allows plant cells to be selected even before the development of a complete plant which exhibits all of the phenotypic characteristics.
The present invention therefore relates to a recombinant plant genome, characterized in that it comprises specific chicory genes and a nucleotide sequence conferring male sterility, which is borne by the sunflower orf 522 sequence or by a sequence with at least 50%, advantageously at least 90%, homology with the said orf 522 sequence.
The orf 522 sequence is a sequence which was revealed in sunflower (Helianthus), in particular
H. annuus
, where it seems to be associated with cytoplasmic male sterility (Köhler et al, Mol. Gen. Genet., 1991, 227: 369-376).
The applicant has found that the presence of this orf 522 sequence in the genome of a plant of the genus Cichorium was linked to cytoplasmic male sterility.
Sequences which are suitable for carrying out the invention comprise sequences borne by the above-described orf 522 sequence, as well as by sequences with a similarity of at least 50%, preferably at least 80%. Suitable sequences advantageously show a similarity of 90% with the said orf 522 sequence, and comprise in particular the sequences which encode the same protein, taking into consideration the degeneration of the genetic code, or a protein in which certain amino acids were replaced by equivalent amino acids. The term “Equivalent amino acids” is understood to mean amino acids which have similar chemical behavior and/or similar molecular weights. They also comprise sequences which encode a protein in which one or more amino acids which are not essential for the activity have been deleted or replaced.
The genome can be of the nuclear or mitochondrial type.
When the sequence is present in the nuclear genome, the latter will also comprise a pre-sequence which allows the Translation product of this sequence to enter the mitochondria.
The recombinant genome is preferably a mitochondrial genome. The invention therefore also relates to a mitochondrion which comprises a recombinant genome as defined above.
In particular, the invention relates to a mitochondrion, characterized in that it comprises at least one nucleotide fragment of 347 bp which is borne by the orf 522 sequence or a sequence with at least 90% homology with the said fragment.
Within the orf 522 sequence (Köhler et al, Mol. Gen. Genet 1991), the 347 bp sequence is flanked by primers of the sequences:
SEQ ID NO 1: 5′CCCCCTCCCTGGTGGATCCGGCG3′
SEQ ID NO 2: 5′CCCTCTATGAGTACCGTTCTCTCACG3′
The invention relates to a recombinant plant cytoplasm, characterized in that it comprises a nucleus comprising the genome of the genus Cichorium and a recombinant genome defined hereinabove, in particular a cytoplasm which comprises mitochondria comprising a nucleotide sequence borne by the
Helianthus annuus
orf 522 sequence or by a sequence with at least 50% homology.
The recombinant plant cells comprising such a cytoplasm are within the scope of the invention, in particular a plant cell which comprises a nucleus comprising essentially the genome of a species selected from amongst
Cichorium intybus
and
Cichorium endivia.
Without limiting the invention in any way, the following cultivation groups may be mentioned amongst these species:
Cichorium intybys
L:
“wild improved” chicories
“Barbe de Capucin” chicories
“sugar loaf” chicories
“Chioggia” chicories
“Verona” chicories
“Catalonia” chicories
“Treviso” chicories
“Variegato di Castelfranco” chicories
“Witloof” chicories (or
“Brussels” chicory or
“chicon” chicory)
“Soncino” chicories
“Industrial” chicories (for roasting and for sugars)
“fodder” or “game”
chicories . . .
Cichorium endivia
L.:
“Scarole” endives
“frisée” endives . . .
These are so-called large-rooted chicories (industrial, fodder and Witloof) or so-called salad chicories (green, red, variegated, for forcing or not).
The expert will be able to apply the invention without difficulty, in particular by referring to “Génétique et Amélioration de la Chicorée industrielle” [Genetics and Improvement of Industrial Chicory], DESPREZ et al., specialist meeting on Nov. 30, 1994, at the Académie d'Agriculture de France, No. 80 (7) 48-49.
According to another aspect the invention relates to a method of producing a plant of the chicory genus or of the reproduction material of this plant which exhibits cytoplasmic male sterility, characterized in that a nucleotide sequence borne by the sunflower orf 522 sequence or by a sequence with at least 50%, preferably at least 90%, homology with the said orf 522 sequence, is integrated into the cell genome of this plant. The scope of the invention extends to the plant (or the production material), with the exception of plant varieties.
It also relates to an essentially non-biological method of preparing plant hybrids, characterized in that a plant which can be obtained by the above-described method is crossed with a plant of the same species which lacks the Helianthus annuus orf 522 sequence or a sequence which has at least 90% homology with the said orf 522 sequence.
In another aspect the invention relates to a method of selecting cytoplasmic male sterility in a plant of the genus Cichorium, characterized in that the mitochondrial nucleic acid of the plant is brought into contact with a labeled probe comprising at least 10 nucleotides of the orf 522 sequence.


REFERENCES:
patent: 5914447 (1999-06-01), Araya et al.
patent: 6066779 (2000-05-01), Yan
patent: 0 771 523 (1997-05-01), None
patent: 2 211 305 (1989-06-01), None
Reeck et al 1987, Cell 50:667.*
Dubreucq et al 1999, Theoretical and Applied Genetics 99:1094-1105.*
Laver et al. The Plant Journal. vol. 1, pp. 185-193, 1991.*
Rambaud et al. Theoretical and Applied Genetics. vol. 87, pp. 347-352, 1993.*
Rambaud et al. Comptes Rendus de l'Academie d'Aggriculture de France. vol. 80, pp. 63-67. (Only Abstract in English), 1994.*
Koehler et al., Cytoplasmic male sterility in sunflower is correlated with the co-transription of a new open reading frame with the atpA gene, vol. 227, No. 3, (1991), pp 369-376, XP000608949.
Rambaud et al., Chicory-sunflower protoplast fusion, Comptes Rendus De L'Academie D'Argriculture De France, vol. 80, No. 7, (1994), pp 63-67, XP000197041. Abstract only.
Rambaud et al., Male-sterile chicory cybirds obtained by intergeneric protoplast fusion, vol. 87, No. 3, (1993), pp 347-352, XP000197036.

Affiliated with

Also associated with

Rating

Methods of making cytoplasmic male sterile chicory plants... does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Methods of making cytoplasmic male sterile chicory plants..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Methods of making cytoplasmic male sterile chicory plants... will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-3289082