Method of detecting hepatitis C virus in tissues

Details Method of detecting hepatitis C virus in tissues Method of detecting hepatitis C virus in tissues

1995-03-31

1998-11-03

Jones, W. Gary

Chemistry: molecular biology and microbiology

Measuring or testing process involving enzymes or...

Involving virus or bacteriophage

435 6, 435912, 435 9151, 935 77, 935 78, C12Q 170, C12Q 168, C12P 1934

Patent

active

058306358

ABSTRACT:
A probe that is a labelled segment of RNA complementary to and capable of specifically hybridizing with denatured HCV RNA, and prepared from 5' sense, GGCGACACTCCACCATGAAT (SEQ ID NO:1) and 3' antisense, CCAGAGCATCTGGCACGTGG (SEQ ID NO:2) primers, from the 5' untranslated region of the HCV genome, is employed for detecting and identifying the presence of hepatitis C virus (HCV) in tissue.

REFERENCES:
Moldvay et al. Blood 83:269-273 (Jan. 1994).
Hu et al. J Clin. Invest 89:2040-2045 (Jun. 1992).
Arrand in Nucleic Acid Hybridisation: A Practical Approach edited by Hames et al. IRL Press, Washington DC pp. 42-45 (1985).
Negro et al. P.N.A.S. USA 89:2247-51 (Mar. 1992).

Affiliated with

Also associated with

Rating

Method of detecting hepatitis C virus in tissues does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Method of detecting hepatitis C virus in tissues, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Method of detecting hepatitis C virus in tissues will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-687787