Chemistry: molecular biology and microbiology – Micro-organism – tissue cell culture or enzyme using process... – Preparing compound containing saccharide radical
Reexamination Certificate
2002-02-22
2004-05-11
Horlick, Kenneth R. (Department: 1637)
Chemistry: molecular biology and microbiology
Micro-organism, tissue cell culture or enzyme using process...
Preparing compound containing saccharide radical
C435S091100, C435S006120, C435S034000, C435S004000, C536S023100, C536S024330
Reexamination Certificate
active
06733999
ABSTRACT:
FIELD OF THE INVENTION
The present invention relates generally to methods for detecting fungi and, more particularly, to methods for the detection and quantitation of the fungus
Stachybotrys chartarum
by means of genetic amplification of a specimen.
BACKGROUND OF THE INVENTION
Molds are ubiquitous in nature and are essential in nutrient cycling. The habitat or habitats that a mold occupies depend on several factors such as the kind and availability of nutrients, competition and spore dispersal. Fungi can occupy natural and man-made habitats in indoor and outdoor environments. These habitats include dead or living plants, decaying or freshly cut wood, food, grains, water and soil. Man-made products such as paint, wallpaper, and cellulose products (e.g., paper, cardboard, and wood derivatives) can be colonized and damaged by fungi, especially under humid or wet conditions. Certain molds can produce toxins that can cause health effects upon direct contact with skin, inhalation or ingestion.
Traditional methods of fungal identification include culture and microscopy analyses. However, these methods are laborious, time-consuming and require expertise. In addition, certain fungi are capable of causing health effects whether they are culturable or non-culturable. Other fungi are unable to produce classical structures under laboratory conditions that are necessary for identification.
Stachybotrys chartarum
is a toxigenic mold that has been implicated in the appearance of health effects in exposed individuals. This slow growing mold can colonize wet materials composed of cellulose. However, due to its specific nutrient and humidity requirements and the competition of other fungi,
S. chartarum
is often underestimated in traditional culture analyses.
Recently, analytical methods have been developed for rapidly and accurately detecting airborne bacteria (Alvarez, A. J., Buttner, M. P., Toranzos, G. A. et al. (1994). The use of solid-phase polymerase chain reaction for the enhanced detection of airborne microorganisms. Applied and Environmental Microbiology 60, 374-376; Alvarez, A. J., Buttner, M. P. & Stetzenbach, L. D. (1995). PCR for bioaerosol monitoring: sensitivity and environmental interference. Applied and Environmental Microbiology 61, 3639-3644), virus (Sawyer, M. H., Chamberlin, C. J., Wu, Y. N., Aintablian, N., & Wallace, M. R. (1994). Detection of varicella-zoster virus DNA in air samples from hospital rooms. Journal of Infectious Disease 169, 91-94) and fungi (Haugland, R. A., Vesper, S. J. & Wymer, L. J. (1999). Quantitative measurement of
Stachybotrys chartarum
conidia using real time detection of PCR products with the TaqMan™ fluorogenic probe system. Molecular and Cellular Probes 13, 329-340; Leenders, A.C.A.P., Van Belkum, A., Behrendt, M., Luijendijk, A. & Verbrugh, H. A. (1999). Density and molecular epidemiology of Aspergillus in air and relationship to outbreaks of Aspergillus infection. Journal of Clinical Microbiology 37, 1752-1757; Vesper, S., Dearborn, D. G., Yike, I. et al. (2000). Evaluation of
Stachybotrys chartarum
in the house of an infant with pulmonary hemorrhage: quantitative assessment before, during, and after remediation. Journal of Urban Health 77, 68-84). These methods use the polymerase chain reaction (PCR) to detect specific microorganisms by amplifying DNA sequences unique to the organism of interest. To use the PCR technique, sequence information must be first identified for a specific target DNA segment. Once an appropriate DNA sequence has been identified, oligonucleotide primers are selected, synthesized, and then tested for sensitivity, specificity, and selectivity. A fluorogenic nuclease assay in conjunction with a sequence detector (ABI PRISM 7700 Sequence Detection System, Applied Biosystems, Foster City, Calif.) has recently been developed as a means to amplify and quantitate PCR products, thus, eliminating the need for post-PCR gel electrophoresis for visualization of results (Heid, C. A., Stevens, J., Livak, K. J. & Williams, P. M. (1996). Real time quantitative PCR. Genome Research 6, 986-994). This method utilizes a fluorescently labeled oligonucleotide probe that anneals between the primers of choice as the amplification reaction proceeds, allowing for the determination of starting copy number of target DNA. The TaqMan™ assay that is integral to this quantitative technology has been previously validated by other researchers with DNA extracted from
Mycobacterium tuberculosis, Listeria monocytogenes
and Salmonella.
PCR detection of
S. chartarum
has been reported (Haugland, R. A. & Heckman, J. L. (1998). Identification of putative sequence specific PCR primers for detection of the toxigenic fungal species
Stachybotrys chartarum
. Molecular and Cellular Probes 12, 387-396; Haugland et al., 1999; Vesper et al., 2000), and quantitative PCR (QPCR) with the TaqMan™ assay has been used for the detection of
S. chartarum
in pure culture and air samples. However, quantitation of the target organism was estimated based on the co-amplification of another fungus (i.e.,
Geotrichum candidum)
and not on direct comparison to
S. chartarum
standards (absolute quantitation). The method of estimated quantitation requires that the organisms co-amplifying have identical primer binding sites and amplification efficiencies, requiring the need for post-PCR processing in order to distinguish the products generated (Heid et al., 1996). In addition, estimated quantitation is inaccurate in cases where PCR inhibitors co-extract with the DNA (Desjardin, L. E., Chen, Y., Perkins, M. D., Teixeira, L., Cave, M. D. & Eisenach, K. D. (1998). Comparison of the ABI 7700 system (TaqMan) and competitive PCR for quantification of IS6110 DNA in sputum during treatment of tuberculosis. Journal of Clinical Microbiology 36, 1964-1968; Haugland et al., 1999).
Therefore, there exists a need for the development of QPCR methods for the detection and absolute quantitation of
S. chartarum.
SUMMARY OF THE INVENTION
Methods consistent with the present invention address this need and others by employing QPCR with novel primers for detecting and quantitating
S. chartarum
without the necessity of further employing estimated quantitation techniques. Quantitation of samples suspected of containing
S. chartarum
, consistent with the present invention, may be based on direct comparison to
S. chartarum
standards (absolute quantitation), thus, avoiding the inaccuracies of estimated quantitation where PCR inhibitors may co-extract with the DNA. The primer and probe set used in QPCR consistent with the present invention may include oligonucleotide primers and a fluorescent probe that were designed from the internal transcribed spacer region (ITS 1) of the 18S rRNA gene of the species
S. chartarum.
In accordance with the purpose of the invention as embodied and broadly described herein, a method for detecting the fungus
Stachybotrys chartarum
includes isolating DNA from a sample suspected of containing the fungus
Stachybotrys chartarum
; subjecting the DNA to polymerase chain reaction amplification utilizing at least one primer, wherein the at least one primer comprises one of (SEQ ID NO: 1) 5′GTTGCTTCGGCGGGAAC3′(SEQ ID NO: 2) 5′TTTGCGTTTGCCACTCAGAG3′, (SEQ ID NO: 3) 5′ACCTATCGTTGCTTCGGCG3′, and (SEQ ID NO: 4) 5′GCGTTTGCCACTCAGAGAATACT3′base sequence; and detecting the fungus
Stachybotrys chartarum
by visualizing the product of the polymerase chain reaction.
In another exemplary embodiment consistent with the invention, a primer set for detecting
Stachybotrys chartarum
using polymerase chain reaction includes a first primer comprising a base sequence (SEQ ID NO: 1) 5′GTTGCTTCGGCGGGAAC3′; and a second primer comprising a base sequence (SEQ ID NO: 2) 5′TTTGCGTTTGCCACTCAGAG3′.
In a further exemplary embodiment consistent with the invention, a primer set for detecting
Stachybotrys chartarum
using polymerase chain reaction includes a first primer comprising a first base sequence (SEQ ID NO: 3) 5
Buttner Mark P.
Cruz-Perez Patricia
Horlick Kenneth R.
University of Nevada
Wilder Cynthia
LandOfFree
Method for detection of Stachybotrys chartarum in pure... does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Method for detection of Stachybotrys chartarum in pure..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Method for detection of Stachybotrys chartarum in pure... will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-3215501