Chemistry: molecular biology and microbiology – Micro-organism – tissue cell culture or enzyme using process... – Recombinant dna technique included in method of making a...
Patent
1997-09-19
2000-07-11
Elliott, George C.
Chemistry: molecular biology and microbiology
Micro-organism, tissue cell culture or enzyme using process...
Recombinant dna technique included in method of making a...
435 6, 435 911, 435 913, 530300, 530324, 530412, 536 231, 536 235, C12N 1500, C12P 1934, C07K 114, C07H 2104
Patent
active
060871237
DESCRIPTION:
BRIEF SUMMARY
The present invention relates to metal-containing ribonucleotide polypeptides (RNP) and to a method for their manufacture, their utilisation and medicines containing ribonucleotide polypeptides or antibodies against ribonucleotide polypeptides and/or their biomolecular equivalent structures and/or portions and/or derivates.
Homeostasis of the tissue of the body, its organs and tissues is dependent on regulatory mechanisms of angiogenesis (lateral and directional growth of the blood vessel capillaries). It influences both tissue repair and wound healing, new tissue formation and embryogenesis and the reproductive cycles as well as accumulation, restitution and destruction of tumours, transplants and tissues, both supplied with, and free of vessels.
Until now, no non-mitogenic mediators have been discovered by whose means an influence can be exerted on tissue homeostasis, i.e. induction and regulation of vessel growth.
The object of the present invention is therefore to prepare a non-mitogenic mediator of tissue homeostasis, by means of which principally tissue repair, wound healing, angiogenesis and neovascularisation can be influenced. A further object of the invention is preparation of a method for manufacturing the non-mitogenic mediators and a medicine, containing this non-mitogenic mediator.
This object is fulfilled by a bioactive ribonucleotide polypeptide according to Patent claim 1, by a method according to Patent claims 5 or 26, by a medicine according to Patent claims 28 or 29 and by utilisation according to Patent claims 30 or 31.
It was discovered by the inventors that there are non-mitogenic cellular mediators on a nucleinic acid basis with a defined sequence, which can specifically cause the formation of blood vessels in vivo and in vitro, and represent biologically specific, naturally-acting non-mitogenic mediators of angiogenesis or of directional growth of blood vessel shoots.
The new class of cellular morphogens for endothelial cells indicated for the first time by the inventors exists in the form of bioactive metal-ribonucleotide peptides (RNP). The metal can preferably be calcium, copper or zinc.
In the RNA portion they contain among other things the following sequence of nucleotides or portions or derivates thereof:
AAAGAGAAAGCUGCUCCGAAGNCAG (SEQ ID NO:1).
protein sequence:
NH.sub.2 -TKLEDHLEGIINIFHQYSVRLG (SEQ ID NO:3)
- HYDTLIKRELKQLITKELPNTLKN
- TKDQGTIDKIFQNLDANQDEQVSF
- KEFVVLVTDVLITAHDNIHKE-COOH
According to the invention the sequences are intended to be so understood that RNP also come under this category, in which in the RNA portion and/or protein portion exchanges of nucleotides and/or amino acids have taken place compared to the sequences shown above, or that only portions of the above sequences are present.
The invention also relates to DNA, coding for the abovenamed amino acids, the DNA comprising: base pairs,
Reverse translated 1-91 T==K==L==E==D==H==L==E==G==I==I==N==I==F==H==Q==Y==S==V==R
20 (SEQ ID NO:3)
ACCAAGCGGAGGACCACCTGGAGGGCATCATCAACATCCCCCACCAGTACTCTGTGCGG
- L==G==H==Y==D==T==L==I==K==R==E==L==K==Q==L==I==T==K==E==L 40
CTGGGCCACTATGACACCCTGATCAAGCGG
GAGCTGAAGCAGCTGATCACCAAGGAGCTG
- P==N==T==L==K==N==T==K==D==Q==G==T==I==D==K==I==F==G==N==L 60
CCCAACACCCTGAAGAACACCAAGGACCAG
GGCACCATTGACAAGATCTTCCAGAACCTG
- D==A==N==Q==D==E==Q==V==S==F==K==E==F==V==V==L==V==T==D==V 80
GATGCCAACCAGGATGAGCAGGTGTCCTCA
AGGAGTTTGTGGCTGGTGACAGATGTG
- L==I==T==A==H==D==N==I==H==
K==E 91
CTGATCACAGCCCATGACAACATCCACAAGGAG
code.
The nucleotides contained in the RNA portion were translated into DNA:
RNA/DNA AAAGAGAAAGCNGCNGCNCCGAAGNCAG
(SEQ ID NO:4)
- CTGNCTTCGGNGCNGCTTTCTCTTT
The RNP according to the invention are further characterised by the following properties: cloned blood capillary endothelial cells in the culture for non-mitogenic induction of the alteration of the cell phenotype from the confluent condition, for non-mitogenic alteration and increase in the cell migration capacity and for non-mitogenic alteration
REFERENCES:
Lloyd, A.W. DDT, vol. 2, No. 10, pp. 397-398 (Oct. 1997).
Journal of Biological Chemistry; "Primary Structure and Binding Properties f Calgranulin C, a Nove. S100-like Calcium-binding Protein from Pig Granulocytes"; Bd. 269, Nr. 46, Nov. 18, 1994; Baltimore, MD US Biochem. Eng., [Int. Congr.] (1987) Meeting Date 1986,.
1.385-9 "An endogenous bioactive metallo-ribonucleo-polypeptide: A copper-containing monocytic blood vessel morphogen as novel type of wound-hormone" Chemical Abstracts, vol. 106, No. 3, Jan. 19, 1987; Columbus, Ohio, US; Abstract No. 16813.
Indian Journal of Medical Research, "Isolation & characterization of tumour angiogenesis factor from solid tumours & body fluids from cancer patients" bd. 90, Aug. 1989, Deshpande et al.
Heilmeyer Ludwig
Kiesewetter Stefan
Logemann Enno
Wissler Josef
Elliott George C.
Fraunhofer-Gesellschaft zur Foerderung der Angewandten Forschung
Shibuya Mark L.
LandOfFree
Metal-containing ribonucleotide polypeptides does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Metal-containing ribonucleotide polypeptides, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Metal-containing ribonucleotide polypeptides will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-540919