Organic compounds -- part of the class 532-570 series – Organic compounds – Carbohydrates or derivatives
Reexamination Certificate
2000-11-28
2004-04-20
Minnifield, Nita (Department: 1645)
Organic compounds -- part of the class 532-570 series
Organic compounds
Carbohydrates or derivatives
C424S093500, C424S130100, C424S184100, C424S185100, C424S195150, C424S278100, C435S203000, C435S254200, C435S454000, C530S388500
Reexamination Certificate
active
06723840
ABSTRACT:
FIELD OF THE INVENTION
The invention provides isolated nucleic acid and amino acid sequences of TL-&ggr;, antibodies to TL-&ggr;, methods of detecting TL-&ggr; and screening for TL-&ggr; modulators using biologically active TL-&ggr;, and kits for screening for TL-&ggr; modulators.
BACKGROUND OF THE INVENTION
The kinesin superfamily is an extended family of related microtubule motor proteins. This family is exemplified by “true” kinesin, which was first isolated from the axoplasm of squid, where it is believed to play a role in anterograde axonal transport of vesicles and organelles (see, e.g., Goldstein,
Annu. Rev. Genet.
27:319-351 (1993)). Kinesin uses ATP to generate force and directional movement associated with microtubules (from the minus to the plus end of the microtubule, hence it is a “plus-end directed” motor). Kinesin superfamily members are defined by a kinesin-like motor that is about 340 amino acids in size and shares approximately 35-45% identity (or more) with the “true” kinesin motor domain. Typically, the motor is attached to a variety of tail domains that provide different binding activities to the various kinesin superfamily members.
The kinesin superfamily encompasses a number of families that exhibit a variety of microtubule motor functions, e.g., vesicle and organelle transport, mitotic spindle function, and meiotic spindle function. One such family is the “unc-104 family” named after unc-104 protein in
C. elegans
(Otsuka et al.,
Neuron
6:13-122 (1991)). Other members of the unc-104 family include mouse Kif1A (murine homolog of unc-104) and Kif1B, and human ATSV (homolog of Kif1A) (Aizawa et al.,
J. Cell Biol.,
119:1287-1296 (1992); Okada et al.,
Cell
81:769-780 (1995); Nangaku et al.,
Cell
79:1209-1220 (1994); and Furlong et al.,
Genomics
33:421-429 (1996)). These proteins typically work as monomers, are ATP dependent, and have plus end-directed microtubule motor activity involved in fast anterograde organelle transport in neurons. Fast anterograde transport is a directional transport typically of membranous organelles such as mitochondria, other organelles and vesicles such as synaptic vesicles, from the cell body to the tip of the axon. Members of the unc-104 family are not found in the first completely sequenced genome of
S. cerevisae,
and on this basis it was believed that fungi did not possess members of the unc-104 motor protein family.
Accordingly, among the objects of this invention is to provide novel members of the kinesin superfamily. It is particularly an object to provide novel kinesins and nucleic acids encoding such kinesins which have anterograde axonal transport activity, including novel members of the unc-104 family, indicated by example, by sequence similarity to known kinesins having such activity. It is also an object to provide methods of use of the compounds provided herein, including methods of diagnosis, treatment of disorders related to the nervous system, treatment of disorders related to fungal infections, bioagricultural, including crop protection, and veterinary applications, and methods of identifying binding agents and modulators of the compounds provided herein.
SUMMARY OF THE INVENTION
The present invention provides for the first time TL-&ggr;, an ATP-dependent, plus end-directed microtubule motor protein that is a member of the unc-104 family and the kinesin superfamily. Previously, the unc-104 family was not thought to exist in fungi. However, the present invention surprisingly provides identification and cloning of a nucleic acid encoding TL-&ggr; from a hyphal fungus.
In one aspect, the invention provides an isolated nucleic acid sequence encoding a kinesin superfamily, plus end-directed microtubule motor protein, wherein the motor protein has the following properties: (i) the protein's activity includes plus end-directed microtubule motor activity; and (ii) the protein has a tail domain that has greater than 60% amino acid sequence identity to a TL-&ggr; tail domain as measured using a sequence comparison algorithm.
In one embodiment, the protein further specifically binds to polyclonal antibodies raised against TL-&ggr; of SEQ ID NO:1.
In one embodiment, the nucleic acid encodes TL-&ggr;. In another embodiment, the nucleic acid encodes SEQ ID NO:1. In another embodiment, the nucleic acid has a nucleotide sequence of SEQ ID NO:2.
In one embodiment, the sequence comparison algorithm is PILEUP.
In one embodiment, the nucleic acid is amplified by primers that selectively hybridize under stringent hybridization conditions to the same sequence as the primer set: 5′ ATGTCGGGCGGTGGAAATATC 3′ (SEQ ID NO:3) and 5′ GAATTCCTGCTTCGCTGTTTTCA 3′(SEQ ID NO:4). In another embodiment, the nucleic acid selectively hybridizes under stringent hybridization conditions to SEQ ID NO:2.
In one embodiment, the nucleic acid has identity to a TL-&ggr; derived from a hyphal fungi. In another embodiment, the nucleic acid has identity to the TL-&ggr; derived from
Thermomyces lanuginosus.
In another aspect, the invention provides an expression vector comprising a nucleic acid encoding a kinesin superfamily, plus end-directed microtubule motor protein, wherein the motor protein has one or more of the properties described above.
In one embodiment, the invention provides a host cell transfected with the vector.
In another aspect, the invention provides an isolated kinesin superfamily, plus end-directed microtubule motor protein, wherein the protein has one or more of the properties described above.
In one embodiment, the protein specifically binds to polyclonal antibodies generated against a tail, motor, or stalk domain of TL-&ggr;. In another embodiment, the protein comprises an amino acid sequence of a TL-&ggr; motor domain of SEQ ID NO:1.
In another aspect, the invention provides an antibody that specifically binds to TL-&ggr;.
In one embodiment, the antibody specifically binds to a tail, motor, or stalk domain of TL-&ggr;.
In another embodiment, the invention further provides chimeric antibodies, humanized antibodies, and the nucleic acids encoding the antibodies provided herein.
In another aspect, the invention provides a method for diagnosing hyphal fungal infections by detecting the presence of TL-&ggr; in a sample, the method comprising the steps of: (i) obtaining a biological sample; (ii) contacting the biological sample with a TL-&ggr; specific reagent that selectively binds to TL-&ggr;; and, (iii) detecting the level of TL-&ggr; specific reagent that selectively associates with the sample.
In one embodiment, the TL-&ggr; specific reagent is selected from the group consisting of: TL-&ggr; specific antibodies, TL-&ggr; specific oligonucleotide primers, and TL-&ggr; nucleic acid probes. In another embodiment, the sample is from a plant or vertebrate, preferably a human. In another embodiment, the specific reagent is part of a gene or protein array.
In another aspect, the invention provides a method for screening for modulators of TL-&ggr;, the method comprising the steps of: (i) contacting biologically active TL-&ggr; with at least one candidate agent at a test and control concentration and detecting whether a change in TL-&ggr; activity occurs between the test and control concentration, wherein a change indicates a modulator of TL-&ggr;. In one embodiment, the activity is selected from the group consisting of plus-end directed microtubule motor activity, ATPase activity and binding activity.
In one embodiment, the method further comprises the step of isolating biologically active TL-&ggr; from a cell sample. In another embodiment, the biologically active TL-&ggr; is recombinant. In another embodiment, the biologically active TL-&ggr; comprises a motor, stalk or tail domain having identity to a motor, stalk or tail domain of
Thermomyces lanuginosus
TL-&ggr;. In another embodiment, the biologically active TL-&ggr; comprises an amino acid sequence of a TL-&ggr; motor domain of SEQ ID NO:1.
In another aspect, the invention provides a kit for screening for modulators of TL-&ggr;, the kit compris
Goldstein Lawrence S. B.
Sakowicz Roman
Hines Ja'Na
Medlen & Carroll LLP
Minnifield Nita
The Regents of the University of California
LandOfFree
Identification and expression of a novel kinesin motor protein does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Identification and expression of a novel kinesin motor protein, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Identification and expression of a novel kinesin motor protein will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-3264471