Human metalloproteinase, variants thereof and DNA sequence codin

Organic compounds -- part of the class 532-570 series – Organic compounds – Carbohydrates or derivatives

Patent

Rate now

  [ 0.00 ] – not rated yet Voters 0   Comments 0

Details

536 243, 536 232, 530350, 435 6, C07H 2102, C07H 2104, C07K 1400, C12Q 168

Patent

active

059902930

DESCRIPTION:

BRIEF SUMMARY
This invention relates to a novel human metalloproteinase, to homologues and fragments thereof, to means for producing the metalloproteinase, and to means for regulating its production and activity in vivo.
A number of physiologically important processing events are mediated by metalloproteinases, which under certain circumstances may contribute to pathologies as diverse as inflammation and cancer, and it has been suggested that such enzymes would provide targets for therapeutic intervention. Thus, by varying the production of the enzyme, or inhibiting or enhancing its activity in vivo it should be possible to achieve a therapeutic effect.
In one example, tumour necrosis factor-alpha (TNF-.alpha.) is a potent pro-inflammatory and immunomodulatory mammalian cytokine produced primarily by activated monocytes and macrophages. It is initially expressed as a 233-amino-acid membrane-anchored precursor (pro-TNF-.alpha.) which is proteolytically processed to yield the mature, 157-amino-acid cytokine. Evidence has been obtained which indicates that at least one metalloproteinase-like enzyme mediates pro-TNF-.alpha. cleavage, but to date the enzyme(s) responsible for this in vivo are unknown [see for example Mohler, K M et al, Nature 370, 218-220 (1994); Gearing, A J et al 370, 555-557 (1994); McGeehan, G M et al, ibid 370, 558-561 (1994)]. A number of known matrix metalloproteinase inhibitors have been shown to block TNF-.alpha. secretion [see the above papers and International Patent Specification Publication No. WO 95/06031]. These compounds were originally designed to selectively inhibit matrix metalloproteinases such as collagenase with primary functions unrelated to pro-TNF-.alpha. cleavage. Where new inhibitors have been described these have apparently been selected on the basis of their effect on TNF-.alpha. secretion seen in cell-based assays.
In another example, L-selectin shedding is thought to be a pro-inflammatory event that is mediated by an as yet unidentified metalloproteinase [Lasky, Science, 258, 964-969 (1992)]. Some inhibitors of L-selectin proteolysis have been identified, but these have been obtained using cell based assays [Walchech et al., Nature, 380, 720-723 (1996); Feehan et al., J. Biol. Chem., 271, 7019-7024 (1996)].
In general, in order to obtain compounds capable of selectively regulating the action of a metalloproteinase implicated in human disease, for example as in the above TNF-.alpha. and L-selectin instances it would be clearly advantageous to have the enzyme unequivocally identified and obtainable in an isolated, purified and unambiguous characterised form.
Through the use of a cloning and screening approach, we have been able to identify human DNA which is responsible for coding one such metalloproteinase. This DNA has the sequence described in SEQ I.D. No: 1 below and may be of use (1) in the production of the metalloproteinase, (2) in the provision of means to regulate the activity of the metalloproteinase in vivo, and (3) in the provision of means to detect and measure a metalloproteinase in a biological system, e.g. in serum, synovial fluid or a tissue extract.
Thus according to one aspect of the invention we provide isolated human DNA comprising the nucleotide sequence of SEQ I.D. No: 1:


SEQ I.D. NO: 1 GAGAAGAGCAGACACCGTGCTCCTGGAATCACCCAGCATGTTGCAA GGTCTCCTGCCAGTCAGTCTCCTCCTCTCTGTTGCAGTAAGTGCTAT AAAAGAACTCCCTGGGGTGAAGAAGTATGAAGTGGTTTATCCTATAA GACTTCATCCACTGCATAAAAGAGAGGCCAAAGAGCCAGAGCAACAG GAACAATTTGAAACTGAATTAAAGTATAAAATGACAATTAATGGAAAAA TTGCAGTGCTTTATTTGAAAAAAAACAAGAACCTCCTTGCACCAGGCT ACACGGAAACATATTATAATTCCACTGGAAAGGAGATCACCACAAGC CCACAAATTATGGATGATTGTTATTATCAAGGACATATTCTTAATGAAA AGGTTTCTGACGCTAGCATCAGCACATGTAGGGGTCTAAGGGGCTAC TTCAGTCAGGGGGATCAAAGATACTTTATTGAACCTTTAAGCCCCATA CATCGGGATGGACAGGAGCATGCACTCTTCAAGTATAACCCTGATGA AAAGAATTATGACAGCACCTGTGGGATGGATGGTGTGTTGTGGGCCC ACGATTTGCAGCAGAACATTGCCCTACCTGCCACCAAACTAGTAAAAT TGAAAGACAGGAAGGTTCAGGAACATGAGAAATACATAGAATATTATT TGGTCCTGGATAATGGTGAGTTTAAAAGGTACAATGAGAATCAAGAT GAGATCAGAAAGAGGGTATTTGAGAT

REFERENCES:
patent: 5270447 (1993-12-01), Liotta et al.
patent: 5280106 (1994-01-01), Lioota et al.
patent: 5372809 (1994-12-01), Liotta et al.
patent: 5482848 (1996-01-01), Dickson et al.
patent: 5698671 (1997-12-01), Stetler-Stevenson et al.
Shapiro et al., J. Biological Chemistry 268(32) : 23,824-23, 829 (1993).
Basset et al., Nature 348 :699-740 (1990).
Takinoi et al., J. of Biological Chemistry 270(39) :23, 013-23, 020 (Sep. 1995).
Sirum et al., Biochemistry 28 :8691-8698 (1989).
Puente et al., Cancer Research 56: 944-949 (Mar. 1996).
Freije et al., Biological Chemistry 269(4) :16,766-16,773 (1994).
Will et al., Eur. of Biochemistry 231 :602-608 (1995).
McKie et al., Biochem. J. 318 : 459-462 (1996).
Levy et al., Genomics 13 :881-883 (1992).
Hite, et al., Biochem., vol. 31, 6203-6211 (1992).
Will, et al., Biochem., vol. 271, No. 29, 17119-17123 (1996).
Pei, et al., Nature, vol. 375, 244-247 (1995).
Crabbe, et al., Biochemistry 33, 14419-14425 (1994).
Murphy, et al., J. of Bio Chem., vol. 267, No. 14, 9612-9618 (1992).
Feehan, et al., . Biochem., vol. 271, No. 12, 7019-7024 (1996).
Walchek, et al., Nature, vol. 380 720-723 (1996).
Lasky, Science, vol. 258, 964-969 (1992).
Mohler, et al., Nature, vol. 370, 218-220 (1994).
Gearing, et al., Nature, vol. 370, 555-561 (1994).
Edamatsu, et al., Biochem., vol. 112, No. 5, 637-642 (1992).
McGeehan, et al., Nature, vol. 370, 558-561 (1994).

LandOfFree

Say what you really think

Search LandOfFree.com for the USA inventors and patents. Rate them and share your experience with other people.

Rating

Human metalloproteinase, variants thereof and DNA sequence codin does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Human metalloproteinase, variants thereof and DNA sequence codin, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Human metalloproteinase, variants thereof and DNA sequence codin will most certainly appreciate the feedback.

Rate now

     

Profile ID: LFUS-PAI-O-1223282

  Search
All data on this website is collected from public sources. Our data reflects the most accurate information available at the time of publication.