Chemistry: molecular biology and microbiology – Measuring or testing process involving enzymes or... – Involving nucleic acid
Reexamination Certificate
2000-07-10
2003-07-01
Carlson, Karen Cochrane (Department: 1653)
Chemistry: molecular biology and microbiology
Measuring or testing process involving enzymes or...
Involving nucleic acid
C536S023100, C435S069100, C435S325000, C435S320100, C435S252300, C530S350000
Reexamination Certificate
active
06586179
ABSTRACT:
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
Not applicable.
FIELD OF THE INVENTION
The invention provides isolated nucleic acid and amino acid sequences of Eag2, antibodies to Eag2, methods of detecting Eag2, and methods of screening for modulators of Eag2 potassium channels using biologically active Eag2. The invention further provides, in a computer system, a method of screening for mutations of human Eag2 genes as well as a method for identifying a three-dimensional structure of Eag2 polypeptide monomers.
BACKGROUND OF THE INVENTION
Potassium channels are involved in a number of physiological processes, including regulation of heartbeat, dilation of arteries, release of insulin, excitability of nerve cells, and regulation of renal electrolyte transport. Potassium channels are thus found in a wide variety of animal cells such as nervous, muscular, glandular, immune, reproductive, and epithelial tissue. These channels allow the flow of potassium in and/or out of the cell under certain conditions. For example, the outward flow of potassium ions upon opening of these channels makes the interior of the cell more negative, counteracting depolarizing voltages applied to the cell. These channels are regulated, e.g., by calcium sensitivity, voltage-gating, second messengers, extracellular ligands, and ATP-sensitivity.
Potassium channels are made by alpha subunits that fall into 8 families, based on predicted structural and functional similarities (Wei et al.,
Neuropharmacology
35(7):805-829 (1997)). Three of these families (Kv, Eag-related, and KQT) share a common motif of six transmembrane domains and are primarily gated by voltage. Two other families, CNG and SK/IK, also contain this motif but are gated by cyclic nucleotides and calcium, respectively. The three other families of potassium channel alpha subunits have distinct patterns of transmembrane domains. Slo family potassium channels, or BK channels have seven transmembrane domains (Meera et al.,
Proc. Natl. Acad. Sci. U.S.A
. 94(25):14066-71 (1997)) and are gated by both voltage and calcium or pH (Schreiber et al.,
J. Biol. Chem
. 273:3509-16 (1998)). Another family, the inward rectifier potassium channels (Kir), belong to a structural family containing 2 transmembrane domains (see, e.g., Lagrutta et al.,
Jpn. Heart. J
. 37:651-660 1996)), and an eighth functionally diverse family (TP, or “two-pore”) contains 2 tandem repeats of this inward rectifier motif.
Potassium channels are typically formed by four alpha subunits, and can be homomeric (made of identical alpha subunits) or heteromeric (made of two or more distinct types of alpha subunits). In addition, potassium channels such as those composed of Kv, KQT and Slo or BK alpha subunits have often been found to contain additional, structurally distinct auxiliary, or beta, subunits. These beta subunits do not form potassium channels themselves, but instead they act as auxiliary subunits to modify the functional properties of channels formed by alpha subunits. For example, the Kv beta subunits are cytoplasmic and are known to increase the surface expression of Kv channels and/or modify inactivation kinetics of the channel (Heinemann et al.,
J. Physiol
. 493:625-633 (1996); Shi et al.,
Neuron
16(4):843-852 (1996)). In another example, the KQT family beta subunit, minK, primarily changes activation kinetics (Sanguinetti et al.,
Nature
384:80-83 (1996)).
The Kv superfamily of voltage-gated potassium channels includes both heteromeric and homomeric channels that are typically composed of four subunits. Voltage-gated potassium channels have been found in a wide variety of tissues and cell types and are involved in processes such as neuronal integration, cardiac pacemaking, muscle contraction, hormone section, cell volume regulation, lymphocyte differentiation, and cell proliferation (see, e.g., Salinas et al.,
J. Biol. Chem
. 39:24371-24379 (1997)).
A family of voltage-gated potassium genes, known as the “Eag” or ether à go-go family, was identified on the basis of a Drosophila behavioral mutation with a leg-shaking phenotype (see, e.g., Warmke & Ganetzky,
Proc. Nat'l Acad. Sci. USA
91:3438-3442 (1994)). Family members from Drosophila and vertebrates have been cloned and fall into three subfamilies. One such subfamily is called the Eag subfamily and is represented, e.g., by Drosophila Eag (Warmke et al.,
Science
252:1560-1562 (1991); Bruggemann et al.,
Nature
365:445-447 (1993)), and rat, mouse, human, and bovine Eags (Ludwig et al.,
EMBO J
. 13:4451-4458 (1994); Robertson et al.
Neuropharmacology
35:841-850 (1996); Occhiodoro et al.,
FEBS Letters
434:177-182 (1998); Shi et al.,
J. Physiol
. 115.3:675-682 (1998); Frings et al.,
J. Gen Physiol
. 111:583-599 (1998)). A second subfamily, the Erg or “Eag-related gene” family is represented, e.g., by human erg (Shi et al.,
J. Neurosci
. 17:9423-9432 (1997)). Finally, a third subfamily, the Elk or “Eag-like K
+
gene” is represented, e.g., by Drosophila Elk (Warmke et al.,
Proc. Natl. Acad. Sci
. 91:3438-3442 (1994)).
SUMMARY OF THE INVENTION
The present invention thus provides for the first time Eag2, a polypeptide monomer that is an alpha subunit of an voltage-gated potassium channel. Eag2 has not been previously cloned or identified, and the present invention provides the nucleotide and amino acid sequence of human Eag2.
In one aspect, the present invention provides an isolated nucleic acid encoding an alpha subunit of a potassium channel, wherein the subunit: (i) forms, with at least one additional Eag family alpha subunit, a potassium channel having the characteristic of voltage sensitivity; and (ii) comprises an amino acid sequence that has greater than about 70% identity to amino acids 720-988 of a human Eag2 amino acid sequence or comprises an amino acid sequence that has greater than about 85% identity to the amino acid sequence of SEQ ID NO:2.
In another aspect, the present invention provides an isolated nucleic acid that selectively hybridizes under moderately stringent hybridization conditions to a nucleotide sequence of SEQ ID NO:1.
In another aspect, the present invention provides an isolated nucleic acid that selectively hybridizes under stringent conditions to a nucleotide sequence of SEQ ID NO:1 or to a nucleotide sequence encoding an amino acid sequence of SEQ ID NO:2.
In another aspect, the present invention provides a method of detecting a nucleic acid, by contacting the nucleic acid with a nucleic acid of the invention.
In another aspect, the present invention provides an isolated alpha subunit of a potassium channel, wherein the subunit: (i) forms, with at least one additional Eag family alpha subunit, a potassium channel having the characteristic of voltage sensitivity; (ii) comprises an amino acid sequence that has greater than about 70% identity to amino acids 720-988 of a human Eag2 amino acid sequence or comprises an amino acid sequence that has greater than about 85% identity to the amino acid sequence of SEQ ID NO:2.
In one embodiment, the polypeptide specifically binds to polyclonal antibodies generated against SEQ ID NO:2.
In one embodiment, the nucleic acid encodes human Eag2. In another embodiment, the nucleic acid encodes SEQ ID NO:2. In another embodiment, the nucleic acid has the nucleotide sequence of SEQ ID NO:1. In another embodiment, the nucleic acid is amplified by primers that selectively hybridize under stringent hybridization conditions to the same sequence as primers selected from the group consisting of:
ATGCCGGGGGGCAAGAGAGGGCTG (SEQ ID NO:3);
CTGACCCTAAGCTCATAAGGATGAAC (SEQ ID NO:4);
CCACCTCATCATCCTGGATGACTTCC (SEQ ID NO:5),
TTAAAAGTGGATTTCATCTTTGTCAGATTCAGG (SEQ ID NO:6);
GGGGACCTCATTTACCATGCTGGAG (SEQ ID NO:7); and
GATTCCCTCATCCACATTTTCAAAGGC (SEQ ID NO:8).
In another embodiment, the polypeptide monomer has a molecular weight of between about 109 kD and about 119 kD. In another embodiment, the polypeptide monomer has the sequence of SEQ ID NO:2.
In another embodiment, the polypeptide monomer comprises an
Jegla Timothy J.
Liu Yi
Carlson Karen Cochrane
ICAgen, Incorporated
Townsend and Townsend / and Crew LLP
LandOfFree
Human Eag2 does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Human Eag2, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Human Eag2 will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-3084200