Multicellular living organisms and unmodified parts thereof and – Nonhuman animal – Transgenic nonhuman animal
Reexamination Certificate
2000-03-24
2001-10-16
Clark, Deborah J. R. (Department: 1633)
Multicellular living organisms and unmodified parts thereof and
Nonhuman animal
Transgenic nonhuman animal
C800S008000, C435S320100, C435S325000, C536S023100, C536S024500
Reexamination Certificate
active
06303845
ABSTRACT:
BACKGROUND OF THE INVENTION
HS-40 is a 350-400 bp enhancer element located about 40 kb upstream of &zgr;-globin gene, which is expressed in the human embryonic erythroblasts but not in the human adult erythroblasts. Specific elements within the HS-40 enhancer have been identified, including GATA-1 motifs, NF-E2/AP1 motifs (a 3′ and a 5′ motif), and a Sp1 binding site.
SUMMARY OF THE INVENTION
The invention is based on the discovery that a single nucleotide change in the 3′NF-E2/AP1 element of the human HS-40 enhancer, unlike the wild type HS-40 enhancer, confers position-independent and copy number-dependent expression on a transgene. In addition, the single nucleotide change allows expression of the gene in the cells of an adult mouse, an effect not seen for the wild type HS-40 enhancer.
Accordingly, the invention features a viral expression vector (e.g., a retrovirus) having a nucleic acid including (1) a transcriptional start site; (2) a promoter (e.g., a tissue-specific promoter such as a &zgr;-globin promoter) operably linked to the transcriptional start site; and (3) an enhancer operably linked to the promoter, the enhancer including the mutated NF-E2/AP1 (mtNF-E2/AP1) DNA sequence TCTGAGTCA (SEQ ID NO:1) or the RNA equivalent thereof The underlined “T” represents a mutation of the wild type “G” in the wild type NF-E2/AP1 (wtNF-E2/AP1) sequence. In a specific embodiment, the enhancer includes the minimal mutated HS-40 DNA sequence
AGATAACTGGGCCAACCATGACTCAGTGCTTCTGGAGGCCAACAGGACTTCT GAGTCATCCTGTGGGGGTGGAGGTGGGACAAGGGAAAGGGGTGAATGGTAC TGCTGATTACAACCTCTGGTGCTGCCTCCCCCTCCTGTTTATCT (SEQ ID NO:2)
or an RNA equivalent thereof. The bold sequence represents the mtNF-E2/AP1 site with the G to T mutation underlined. The minimal HS-40 enhancer sequence excludes a 5′ GATA1(b) site because it has been shown that this site is not necessary for HS-40 enhancer activity (Zhang et al., J Biol Chem 270:8501-8505, 1995).
The enhancer can also include the fall mutated HS-40 enhancer sequence:
TCGACCCTCTGGAACCTATCAGGGACCACAGTCAGCCAGGCAAGCACATCTG CCCAAGCCAAGGGTGGAGGCATGCAGCTGTGGGGGTCTGTGAAAACACTTGA GGGAGCAGATAACTGGGCCAACCATGACTCAGTGCTTCTGGAGGCCAACAGG ACTTCTGAGTCATCCTGTOGGOGTGGAOGTGGGACAAGGGAAAGGGGTGAA TGGTACTGCTGATTACAACCTCTGGTGCTGCCTCCCCCTCCTGTTTATCTGAG AGGGAAGGCCATGCCCAAAGTGTTCACAGCCAGGCTTCAGGGGCAAAGCCT GACCCAGACAGTAAATACGTTCTTCATCTGGAGCTGAAGAAATTC (SEQ ID NO:3)
or an RNA equivalent thereof The bold sequence represents the mtnf-E2/AP1 site with the G to T mutation underlined. This sequence is referred to herein as the mtHS-40 sequence, which differs from the wild type HS-40 (wtHS-40) sequence by the G/T mutation indicated above. Again, the single mutation is underlined. The vector can also contain a transcriptional termination signal (e.g., a polyadenylation signal). In other embodiments, the promoter drives transcription of a MRNA encoding a polypeptide (e.g., a growth hormone), the transcription beginning from the transcriptional start site.
A promoter is a nucleotide sequence required to facilitate transcription from a transcriptional start site, which is the site at which the first nucleotide of the transcript is transcribed, the nucleotide being complementary to the corresponding nucleotide in the nucleic acid. A promoter operably linked to a transcriptional start site means that the promoter is capable of driving transcription from the transcriptional start site in the absence of farther nucleotide sequences.
An enhancer is a nucleic acid sequence which increases the level of transcription from a promoter. Enhancers need not be in any specified position in the nucleic acid in relation to the promoter, transcriptional start site, or transcriptional termination site. All that is required for a specific enhancer to be operably linked to a specific promoter is that the presence of the enhancer increases transcription driven by that promoter.
A transcriptional termination signal is a nucleic acid sequence which terminates transcription of a transcript. A variety of promoters, enhancers, and transcriptional termination signals are known in the art.
A viral expression vector is any combination of a nucleic acid and at least one protein which is useful for delivering a nucleic acid into a cell so as to express a transcript encoded by the nucleic acid in the cell. Other components, such as a lipid bilayer can also be present in the vector. An example of a viral expression vector is a retrovirus.
The invention also includes a transgenic animal (e.g., a mouse or other rodent, pig, rat, cow, chicken, turkey, or sheep) whose somatic and germ line cells contain at least one copy of a transgene comprising (1) a transcriptional start site; (2) a promoter (e.g., a tissue-specific promoter such as a &zgr;-globin promoter) operably linked to the open reading frame; and (3) an enhancer operably linked to the promoter. The enhancer includes the nucleotide sequence of SEQ ID NO:1 (e.g., SEQ ID NO:2). The transgenic animal expresses a transcript driven by the promoter, where the level of expression in at least one cell type (e.g., a erythroblast) of the animal is proportionally dependent on the copy number of the transgene, i.e., the greater the copy number, the greater the expression. Such a transcript can be a mRNA encoding a polypeptide (e.g., a growth hormone). In other embodiments, the somatic and germ line cells contain more than 5 copies (e.g., more than 15 copies) of the transgene.
The invention also features a method of expressing a transcript in an animal (e.g., a mouse, pig, rat, cow, chicken, turkey, or sheep) by administering to the animal a nucleic acid comprising (1) an transcriptional start site for the transcript; (2) a promoter (e.g., a tissue-specific promoter such as a &zgr;-globin promoter) operably linked to the transcriptional start site; and (3) an enhancer operably linked to the promoter, the enhancer comprising the DNA sequence of SEQ ID NO:1 or 2 or the RNA equivalent thereof. The transcript can be a mRNA encoding a polypeptide. The nucleic acid can be administered by parenteral injection (e.g., intramuscular injection) or via a viral expression vector. The nucleic acid can further include a transcriptional termination signal (e.g., a polyadenylation signal).
Nucleic acids and viral vectors containing an enhancer having the mtNF-E2/AP1 sequence described above can be used to express a therapeutic antisense RNA or mRNA encoding a therapeutic polypeptide in an animal in a position-independent and transgene copy number dependent manner. This was an unexpected result because, previously, transgene expression was limited by position-effect variegation, silencing of transgenes, and the inability to increase expression by increasing the copy number of the transgene. See, e.g., Sabl et al., Genetics 142:447-458, 1996; Palmer et al., Sharpe et al., EMBO J 11:4565-4572, 1992; and Chen et al., Proc Natl Acad Sci USA 94:5798-5803, 1997. By inclusion of an enhancer containing the mtNF-E2/AP1 sequence in the transgene sequence, these deficiencies in transgene expression are removed. Enhancement of transgene expression can result in transgenic animal models exhibiting more severe symptoms so that therapeutic efficacy in those models can be measured in a wider range of symptom severity. Examples of such models, which can be improved by the present invention, are described in U.S. Pat. Nos. 5,811,634 and 5,675,060
REFERENCES:
Wall RJ Theriogenology 45:57-68, 1996.*
Kappel et al. Current Opinion in Biotechnology 3:548-553, 1992.*
Viville, in Transgenic Animals, Houdebine (eds), Harwood academic publishers, France. pp307-321, 1997.*
Anderson WF, Nature 392:25-30, 1998.*
Verma et al Nature 389:239-242, 1997.*
Kay et al, PNAS 94:12744-12746, 1997.*
Pondel et al. Nucleic Acid Res. 24(2):4158-64, 1996.*
Zang et al. Mol. Cell. Bio. 13(4):2298-2308, 1993.*
Jarman et al Mol. Cell. Bio. 11(9):4679-4689, 1991.*
Andrews et al., “Erythoid Transcriptional Factor . . . ,” Nature, 362:722-728, 1993.
Chan et al., “Cloning Nrfl . . . ,” Proc. Natl. Acad. USA, 90:11371-11375, 1993.
Chen et
Academia Sinica
Clark Deborah J. R.
Fish & Richardson P.C.
Kaushal Sumesh
LandOfFree
HS-40 enhancer-containing vector does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with HS-40 enhancer-containing vector, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and HS-40 enhancer-containing vector will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-2607638