Heptahelix receptor and its use

Details Heptahelix receptor and its use Heptahelix receptor and its use

1998-10-13

2002-12-03

Spector, Lorraine (Department: 1646)

Chemistry: natural resins or derivatives; peptides or proteins;

Proteins, i.e., more than 100 amino acid residues

C530S402000, C435S007200, C435S007230

Reexamination Certificate

active

06489442

ABSTRACT:

BACKGROUND OF THE INVENTION
This invention relates to a new chemoattractant receptor and its use. More particularly, this invention relates to cDNA encoding a novel heptahelix receptor widely distributed in brain and peripheral tissues. This invention also relates to the use of the receptor for detecting Burkitt's lymphoma cells.
The G-protein coupled (heptahelix) membrane receptors (1) receive chemical signals in cell communication both in CNS and in the peripheral tissues. Interest has recently focused also on the immune system because this receptor type is recognized by many chemoattractant peptides, the model substances being IL8 (2,3), and heptahelix receptors are now recognized also among cluster determinant antigens in immune cells, i.e., CDw78 (4) and CD97 (5).
In addition, the G-protein coupled receptors may be involved in other functional mechanisms, such as viral pathogenesis. Thus, the human cytomegalovirus shows structural homology with heptahelix receptors (6) and encodes a functional chemokine receptor (7), and
Herpesvirus saimiri
exerts “molecular piracy” entry of HIV-1 into CD4-positive cells is mediated by two distinct chemoattractant receptors (9-10).
Herpesvirus saimiri
is closely related to the B lymphotropic Epstein-Barr virus (EBV). This is implicated in several human malignancies, such as Burkitt's lymphoma, which expresses BLR1, the first example of a heptahelix (chemokine-like) receptor identified specifically in the lymphocyte lineage of the hematopoietic system (11).
Because of the continuing interest in chemoattractant receptors, there exists a need in the art for the identification of new receptors and the elucidation of their structure so that the function of these receptors in humans can be determined. In particular, there exists a need in the art for sequence information on such receptors, including DNA and amino acid sequences, to enable the isolation and characterization of particular receptors as well as structurally related receptors. The identification of receptors associated with pathogenic conditions would be particularly advantageous in assays for the identification of these conditions in susceptible individuals.
SUMMARY OF THE INVENTION
Accordingly, this invention aids in fulfilling these needs in the art. More particularly, this invention provides a B-cell derived heptahelix receptor that is strongly expressed in brain and peripheral tissues. The receptor can be detected in Burkitt's lymphoma cells. A receptor of human origin shows structural identity with both the IL8 receptors and with the co-receptors for HIV-1.
More particularly, the present invention provides isolated heptahelix receptors and DNA sequences encoding these heptahelix receptors. Such DNA sequences include (a) cDNA clones having a nucleotide sequence derived from the coding region of a native heptahelix receptor gene of the invention; (b) DNA sequences that are capable of hybridization to the cDNA clones of (a) under moderately stringent conditions and which encode biologically active heptahelix receptor molecules; and (c) DNA sequences that are degenerate as a result of the genetic code to the DNA sequences defined in (a) and (b) and which encode biologically active heptahelix receptor molecules.
The present invention also provides recombinant expression vectors comprising the DNA sequences defined above, recombinant heptahelix receptor molecules produced using the recombinant expression vectors, and processes for producing the recombinant heptahelix receptor molecules using the expression vectors.
The present invention further provides isolated or purified protein compositions comprising heptahelix receptor of the invention.
In one embodiment of the invention, a heptahelix receptor of the invention has the following amino acid sequence and corresponding nucleotide sequence:
   1
M  D  V  T  S  Q  A  R  G  V  G  L  E  M  Y  P  G  T  A  Q  P  A  A  P  N  T  T  E  P  E  L  M  L  S  M  P  L  L  G  T
  40
   1
atggatgtgacttcccaagcccggggcgtgggcctggagatgtacccaggcaccgcgcagcctgcggcccccaacaccacctcccccgagctcaacctgtcccacccgctcctgggcacc
 120

                                                   
                              I                                    
  41
A  L  A  N  G  T  G  E  L  S  E  H  Q  Q  Y  V  I  G  L  F  L  S  C  L  Y  T  I  F  L  F  P  I  G  F  V  G  M  I  L  I
  80
 121
gccctggccaatgggacaggtgagctctcggagcaccagcagtacgtgatcggcctgttcctctcgtgcctctacaccatcttcctcttccccatcggctttgtgggcaacatcctgate
 240

                                            
                                II                            
  81
L  V  V  M  I  S  F  R  I  R  M  T  I  P  D  L  Y  Y  I  N  L  A  V  A  D  L  I  L  V  A  D  S  L  I  E  V  F  N  L  N
 120
 241
ctggtggtgaacatcagcttccgcgagaagatgaccatccccgacctgtacttcatcaacctggcggtggcggacctcatcctggtggccgactccctcattgaggtgttcaacctgcac
 360

                                
                                III                              
 121
E  R  Y  Y  D  I  A  V  L  C  T  F  M  S  L  F  L  Q  V  N  M  Y &em

Affiliated with

Also associated with

Rating

Heptahelix receptor and its use does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Heptahelix receptor and its use, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Heptahelix receptor and its use will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-2985637