Chemistry: molecular biology and microbiology – Measuring or testing process involving enzymes or... – Involving nucleic acid
Reexamination Certificate
2000-07-13
2003-11-04
Siew, Jeffrey (Department: 1637)
Chemistry: molecular biology and microbiology
Measuring or testing process involving enzymes or...
Involving nucleic acid
C435S091200, C536S025320, C436S501000
Reexamination Certificate
active
06642001
ABSTRACT:
BACKGROUND OF THE INVENTION
Nucleic acid analysis techniques that identify alterations or polymorphisms within known sequences are useful in many aspects of scientific, medical and forensic fields. For example, these techniques can be used in the genotyping of individuals in order to diagnose hereditary diseases or provide prognosis based on known genetic lesions. These techniques can also be used for clinical purposes such as tissue typing for histocompatibility or for forensic purposes such as identity or paternity determination. Furthermore, nucleic acid analysis techniques can be used for the identification of organisms or to distinguish or identify pathogenic organisms or infectious agents. In addition, these techniques are useful in the identification and monitoring of genetically modified agricultural organisms such as crops and livestock. As genomic sequence of organisms from bacteria to humans become known, the need for nucleic acid analysis techniques that are rapid and inexpensive increases.
Nucleic acids are readily analyzed and quantitated using probe-based assays. The presence of nucleic acid sequences from bacteria, fungi, viruses or other organisms is assayed with nucleic acid probes and such probes are also useful in examining genotypes, genetically-based disease states or other clinical conditions of interest. Genotypes of interest include, for example, point mutations, deletions, insertions and inversions. Furthermore, these assays are useful to detect and monitor polymorphisms within nucleic acid sequences of interest.
Probe-based assays typically rely on nucleic acid hybridization. Sequence differences of a single base (e.g., point mutation) in very short oligomers (e.g., <10 base pairs (“bp”) can be sufficient to enable the discrimination of the hybridization to complementary nucleic acid target sequences as compared with non-target sequences. However, nucleic acid probes of greater than 10 bp in length are often preferred or required to obtain the sequence specificity necessary to correctly identify a unique organism, disease state or clinical condition of interest.
Using hybridization assays, large numbers of patient samples can be screened for a large number of loci of interest. Yet, given the requirement that each of the many different probes in the assay exhibit a very high degree of specificity for a specific target nucleic acid sequence under the same or similar conditions of stringency it is often difficult to assay more than one sample and or more than one locus of interest (e.g., multiplex assays).
An alternative method for identifying and analyzing one or more polymorphisms is based on single-base extension (SBE) of a fluorescently-labeled primer coupled with fluorescence resonance energy transfer (FRET) between the label of the added base and the label of the primer. Typically, the method, such as that described by Chen et al., (
PNAS
94:10756-61 (1997), incorporated herein by reference) uses a locus-specific oligonucleotide primer labeled on the 5′ terminus with 5-carboxyfluorescein (FAM). This labeled primer is designed so that the 3′ end is immediately adjacent to the polymorphic site of interest. The labeled primer is hybridized to the locus, and single base extension of the labeled primer is performed with fluorescently labeled dideoxyribonucleotides (ddNTPs) in dye-terminator sequencing fashion, except that no deoxyribonucleotides are present. An increase in fluorescence of the added ddNTP in response to excitation at the wavelength of the labeled primer is used to infer the identity of the added nucleotide. However, this method requires the use of labeled target-specific oligonucleotide primers for each polymorphism assayed.
SUMMARY OF THE INVENTION
The present invention relates to a method for determining and analyzing polymorphisms which eliminates the need for labeled target-specific primers. In one embodiment of the present invention, traditional SBE/FRET protocols are modified in that unlabeled primers are used which comprise a generic or constant sequence on the 5′ end of the primer. The generic sequence is complementary to a fluorescently-labeled detection probe (e.g., a FAM-labeled detection probe). Thus, identical FAM-labeled detection probes can be used for any primer with the generic sequence on the 5′ end. This obviates the need for specialized labeled primers and allows for a generic SBE/FRET assay. FRET occurs if the detection probe is hybridized to a primer having a nucleotide with a fluorescent acceptor molecule attached thereto (a labeled nucleotide), wherein said labeled nucleotide was added to the primer by template-dependent synthesis, such that it is complementary to the nucleotide of interest or polymorphic nucleotide of interest. The present invention retains all of the advantages and uses of standard SBE/FRET, and has the additional advantage of not requiring expensive, target specific primers that are labeled with donor fluorescent molecules. Furthermore, the present invention has the advantage that the detection probe can be reused.
In one embodiment, the present invention is drawn to a method of determining the identity of a nucleotide at a specific location within a nucleic acid sequence of interest. The present invention is also drawn to a method for determining the identity of a nucleotide of interest at one or more polymorphic sites in at least one nucleic acid sequence of interest. The method comprises forming at least one detection complex comprising a generic detection probe comprising a detection sequence and a donor fluorescent molecule, and an extended primer wherein the primer is extended with a labeled nucleotide by template-dependent synthesis, using the nucleic acid molecule of interest, and more particularly the nucleotide of interest, as the template. The primer of the present invention comprises a variable nucleic acid sequence and a nucleic acid sequence (a generic or constant sequence) which hybridizes to (e.g., is complimentary to) said detection sequence. In the method of the present invention, the variable portion of said primer hybridizes to a region of the nucleic acid sequence of interest immediately adjacent to a nucleotide of interest and said labeled nucleotide is complementary to said nucleotide of interest. In the method of the present invention, the detection complexes formed are detected by fluorescence resonance energy transfer from the donor fluorescent molecule to the acceptor fluorescent molecule. In one embodiment, the nucleic acid sequence of interest is also part of the detection complex.
Thus, in the method of the present invention, one or more nucleotides of interest (e.g., at a polymorphic site) in at least one nucleic acid sequence of interest is detected by fluorescence resonance energy transfer from a donor fluorescent molecule on a generic detection probe to an acceptor fluorescent molecule on an extended target-specific primer. For example, when different acceptor fluorescent molecules are used to label the different nucleotides used in the single base extension reaction, the resulting fluorescence resonance energy transfer when a given labeled nucleotide is present in the detection complex with the donor fluorescent molecule, allows differentiation between polymorphic nucleotides at the extended position.
The present invention is further drawn to a detection probe comprising a detection sequence of about 10 to about 40 nucleotides in length, wherein said probe is labeled with a donor fluorescent molecule. In one embodiment the present invention is drawn to a detection probe comprising FAM-GGGCCGGGACCGACCGCGCG (SEQ ID NO: 1).
The present invention is also drawn to a primer comprising a nucleic acid sequence of about 10 to about 110 nucleotides in length, wherein said primer comprises a variable region and a constant region. For example, in one embodiment of the present invention, the constant region comprises CGCGCGGTCGGTCCCGGCCC (SEQ ID NO:2).
The present invention is further drawn to a kit for the detection of at least one nucleotide
Bolk Stacey
Hirschhorn Joel N.
Ireland James S.
Lander Eric S.
Hamilton Brook Smith & Reynolds P.C.
Siew Jeffrey
Tung Joyce
Whitehead Institute for Biomedical Research
LandOfFree
Generic SBE-FRET protocol does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Generic SBE-FRET protocol, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Generic SBE-FRET protocol will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-3119631