Chemistry: molecular biology and microbiology – Micro-organism – tissue cell culture or enzyme using process... – Recombinant dna technique included in method of making a...
Reexamination Certificate
2000-03-14
2003-10-28
Mertz, Prema (Department: 1646)
Chemistry: molecular biology and microbiology
Micro-organism, tissue cell culture or enzyme using process...
Recombinant dna technique included in method of making a...
C435S071100, C435S071200, C435S325000, C435S471000, C435S252300, C435S254110, C435S320100, C536S023500, C536S024100, C536S024310, C530S350000
Reexamination Certificate
active
06638733
ABSTRACT:
CROSS-REFERENCES TO RELATED APPLICATIONS
Not applicable.
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
Not applicable.
FIELD OF THE INVENTION
The invention provides isolated nucleic acid and amino acid sequences of four novel G-protein coupled receptors that are amplified in breast cancer cells, antibodies to such receptors, methods of detecting such nucleic acids and receptors, and methods of screening for modulators of G-protein coupled receptors.
BACKGROUND OF THE INVENTION
G-protein coupled receptors are cell surface receptors that indirectly transduce extracellular signals to downstream effectors, which can be intracellular signaling proteins, enzymes, or channels, and changes in the activity of these effectors then mediate subsequent cellular events. The interaction between the receptor and the downstream effector is mediated by a G-protein, a heterotrimeric protein that binds GTP. G-protein coupled receptors (“GPCRs”) typically have seven transmembrane regions, along with an extracellular domain and a cytoplasmic tail at the C-terminus. These receptors form a large superfamily of related receptors molecules that play a key role in many signaling processes, such as sensory and hormonal signal transduction. For example, a large family of olfactory GPCRs has been identified (see, e.g., Buck & Axel,
Cell
65:175-187 (1991)). The further identification of GPCRs is important for understanding the normal process of signal transduction and as well as its involvement in pathologic processes. For example, GPCRs can be used for disease diagnosis as well as for drug discovery. Further identification of novel GPCRs is therefore of great interest.
SUMMARY OF THE INVENTION
The present invention thus provides for the first time four novel nucleic acids encoding G protein coupled receptors that are amplified in breast cancer cells. These nucleic acids and the polypeptides that they encode are referred to as “breast cancer amplified G-protein coupled receptors” or “BCA-GPCRs,” i.e., “BCA-GPCR-1,” “BCA-GPCR-2, ” “BCA-GPCR-3, ” and “BCA-GPCR-4. ” These BCA-GPCRs are components of signal transduction pathways in cells, and can be used for diagnosis of cancer, in particular breast cancers, as well as in screening assays for therapeutic compounds, e.g., for the treatment of cancer.
In one aspect, the present invention provides an isolated nucleic acid encoding a G-protein coupled receptor polypeptide, the polypeptide encoded by the nucleic acid comprising greater than 70% amino acid identity to an amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8.
In another aspect, the present invention provides an isolated nucleic acid encoding a G-protein coupled receptor polypeptide, wherein the nucleic acid specifically hybridizes under stringent hybridization conditions to a nucleic acid having a nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:7.
In another aspect, the present invention provides an isolated nucleic acid encoding a G-protein coupled receptor polypeptide, the polypeptide encoded by the nucleic acid comprising greater than about 70% amino acid identity to a polypeptide having an amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 or SEQ ID NO:8, wherein the nucleic acid selectively hybridizes under moderately stringent hybridization conditions to a nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:7.
In another aspect, the present invention provides an expression vector comprising an isolated nucleic acid encoding a G-protein coupled receptor of the invention, and a host cell comprising the expression vector.
In one embodiment, the nucleic acid comprises a nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:7. In another embodiment, the nucleic acid is from a human, a mouse, or a rat. In another embodiment, the nucleic acid is amplified by primers that specifically hybridize under stringent hybridization conditions to the same sequence as primer sets selected from the group consisting of:
ATGTTGGGGAACGTCGCCATC (SEQ ID NO:9) and
TCATCCACAGAGCCTCCAGAT (SEQ ID NO:10);
ATGGGAAAGGACAATCCAGTT (SEQ ID NO:11) and
CTAAGAGAGTAACTCCAGCAA (SEQ ID NO:12);
ATGGAAATAGCCAATGTGAGTTC (SEQ ID NO:13) and
TAAATTTGCGCCAGCTTGCCTG (SEQ ID NO:14); and
ATGGTGAGACATACCAATGAGAG (SEQ ID NO:15) and
CATAAAATATTTACTCCCAGAGCC (SEQ ID NO:16).
In another aspect, the present invention provides an isolated G-protein coupled receptor polypeptide, the polypeptide comprising greater than about 70% amino acid sequence identity to an amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8.
In one embodiment, the polypeptide specifically binds to polyclonal antibodies generated against SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 or SEQ ID NO:8. In another embodiment, the polypeptide is from a human, a rat, or a mouse. In another embodiment, the polypeptide has an amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 or SEQ ID NO:8.
In one embodiment, the polypeptide has G-protein coupled receptor activity.
In another aspect, the invention provides an antibody that binds to an isolated G-protein coupled receptor polypeptide, the polypeptide comprising greater than about 70% amino acid sequence identity to an amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8.
In another aspect, the present invention provides a method for identifying a compound that modulates signal transduction, the method comprising the steps of: (i) contacting the compound with a polypeptide comprising greater than 70% amino acid sequence identity to the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8; and (ii) determining the functional effect of the compound upon the polypeptide.
In one embodiment, the polypeptide is linked to a solid phase. In another embodiment, the polypeptide is covalently linked to a solid phase.
In one embodiment, the functional effect is determined by measuring changes in intracellular cAMP, IP3, or Ca
2+
. In another embodiment, the functional effect is a chemical effect or a physical effect. In another embodiment, the functional effect is determined by measuring binding of the compound to the polypeptide.
In one embodiment, the polypeptide is recombinant. In another embodiment, the polypeptide is expressed in a cell or cell membrane, e.g., a eukaryotic cell or cell membrane.
In another aspect, the present invention provides a method of modulating signal transduction from a G-protein coupled receptor, the method comprising the step of contacting the G-protein coupled receptor with an effective amount of a compound identified by (i) contacting the compound with a polypeptide comprising greater than 70% amino acid sequence identity to the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8; and (ii) determining the functional effect of the compound upon the polypeptide.
In another aspect, the present invention provides a method of treating cancer, the method comprising the step of contacting a cancer cell with an effective amount of a compound identified by (i) contacting the compound with a polypeptide comprising greater than 70% amino acid sequence identity to the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8;and (ii) determining the functional effect of the compound upon the polypeptide.
In another aspect, the present invention provides a method of detecting the presence of an BCA-GPCR nucleic acid or polypeptide in human tissue, the method comprising the steps of: (i) isolating a biological sample; (ii) contacting the biological sample with a BCA-GPCR-specific reagent that selectively associates with an BCA-GPCR nucleic acid or polypeptide; and, (iii) detecting the level of BCA-GPCR-specific reagent that selectively associates with the sample.
In one embodiment, the BCA-GPCR-specific reagent is selected from the group consisting of: BCA-GPCR-specific antibodies, BCA-GPCR-specific oligonucleotide primers, and BCA-GPCR-specific nucleic acid prob
Cutler Gene
Powers Scott
Yang Jianxin
Mertz Prema
Tularik Inc.
LandOfFree
G-protein coupled receptors amplified in breast cancer does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with G-protein coupled receptors amplified in breast cancer, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and G-protein coupled receptors amplified in breast cancer will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-3138616