Chemistry: molecular biology and microbiology – Micro-organism – tissue cell culture or enzyme using process... – Recombinant dna technique included in method of making a...
Reexamination Certificate
1999-08-31
2001-09-25
Allen, Marianne P. (Department: 1631)
Chemistry: molecular biology and microbiology
Micro-organism, tissue cell culture or enzyme using process...
Recombinant dna technique included in method of making a...
C435S069700, C435S320100, C435S325000, C435S006120, C435S183000, C536S023200, C536S023700
Reexamination Certificate
active
06294357
ABSTRACT:
FIELD OF THE INVENTION
This invention relates to newly identified polynucleotides and polypeptides, and their production and uses, as well as their variants, agonists and antagonists, and their uses. In particular, the invention relates to polynucleotides and polypeptides of the fabF family, as well as their variants, herein referred to as “fabF,” “fabF polynucleotide(s),” and “fabF polypeptide(s)” as the case may be.
BACKGROUND OF THE INVENTION
The pathway for the biosynthesis of saturated fatty acids is very similar in prokaryotes and eukaryotes. However, whilst the chemical reactions may not vary, the organization of the biosynthetic apparatus is very different. Vertebrates and yeasts possess type I fatty acid synthases (FASs) in which all of the enzymatic activities are encoded on one or two polypeptide chains, respectively. The acyl carrier protein (ACP) is an integral part of the complex. In contrast, in most bacterial and plant FASs (type II) each of the reactions are catalyzed by distinct monofunctional enzymes and the ACP is a discrete protein. Mycobacteria are unique in that they possess both type I and II FASs. There therefore appears to be considerable potential for selective inhibition of the bacterial systems by broad spectrum antibacterial agents (Rock, C. & Cronan, J. 1996.
Biochimica et Biophysica Acta
1302, 1-16; Jackowski, S. 1992. In
Emerging Targets in Antibacterial and Antifungal Chemotherapy
. Ed. J. Sutcliffe & N. Georgopapadakou. Chapman & Hall, New York; Jackowski, S. et al. (1989).
J Biol. Chem.
264, 7624-7629.)
The first step in the biosynthetic cycle is the condensation of malonyl-ACP with acetyl-CoA by FabH. Prior to this, malonyl-ACP is synthesized from ACP and malonyl-CoA by FabD, malonyl CoA:ACP transacylase. In subsequent rounds malonyl-ACP is condensed with the growing-chain acyl-ACP (FabB and FabF, synthases I and II respectively). The second step in the elongation cycle is ketoester reduction by NADPH-dependent &bgr;-ketoacyl-ACP reductase (FabG). Subsequent dehydration by &bgr;-hydroxyacyl-ACP dehydrase (either FabA or FabZ) leads to trans-2-enoyl-ACP which is in turn converted to acyl-ACP by enoyl-ACP reductase (FabI). Further rounds of this cycle, adding two carbon atoms per cycle, eventually lead to palmitoyl-ACP whereupon the cycle is stopped largely due to feedback inhibition of FabH and I by palmitoyl-ACP (Heath, et al, (1996),
J.Biol.Chem.
271, 1833-1836).
Cerulenin and thiolactomycin are potent and selective inhibitors of bacterial fatty acid biosynthesis. Extensive work with these inhibitors has proved that this biosynthetic pathway is essential for bacterial viability. No marketed antibiotics are targeted against fatty acid biosynthesis, therefore it is unlikely that novel antibiotics would be rendered inactive by known antibiotic resistance mechanisms. There is an unmet need for developing new classes of antibiotic compounds, such as those that target FabF.
FabF enzymes are of interest as Potential targets for antibacterial agents.
It is particularly preferred to employ Staphylococcal genes and gene products as targets for the development of antibiotics. The Staphylococci make up a medically important genera of microbes. They are known to produce two types of disease, invasive and toxigenic. Invasive infections are characterized generally by abscess formation effecting both skin surfaces and deep tissues.
S. aureus
is the second leading cause of bacteremia in cancer patients. Osteomyelitis, septic arthritis, septic thrombophlebitis and acute bacterial endocarditis are also relatively common. There are at least three clinical conditions resulting from the toxigenic properties of Staphylococci. The manifestation of these diseases result from the actions of exotoxins as opposed to tissue invasion and bacteremia. These conditions include: Staphylococcal food poisoning, scalded skin syndrome and toxic shock syndrome.
The frequency of
Staphylococcus aureus
infections has risen dramatically in the past few decades. This has been attributed to the emergence of multiply antibiotic resistant strains and an increasing population of people with weakened immune systems. It is no longer uncommon to isolate
Staphylococcus aureus
strains that are resistant to some or all of the standard antibiotics. This phenomenon has created an unmet medical need and demand for new anti-microbial agents, vaccines, drug screening methods, and diagnostic tests for this organism.
Moreover, the drug discovery process is currently undergoing a fundamental revolution as it embraces “functional genomics,” that is, high throughput genome- or gene-based biology. This approach is rapidly superseding earlier approaches based on “positional cloning” and other methods. Functional genomics relies heavily on the various tools of bioinformatics to identify gene sequences of potential interest from the many molecular biology databases now available as well as from other sources. There is a continuing and significant need to identify and characterize further genes and other polynucleotides sequences and their related polypeptides, as targets for drug discovery.
Clearly, there exists a need for polynucleotides and polypeptides, such as the fabF embodiments of the invention, that have a present benefit of, among other things, being useful to screen compounds for antimicrobial activity. Such factors are also useful to determine their role in pathogenesis of infection, dysfunction and disease. There is also a need for identification and characterization of such factors and their antagonists and agonists to find ways to prevent, ameliorate or correct such infection, dysfunction and disease.
SUMMARY OF THE INVENTION
The present invention relates to fabF, in particular fabF polypeptides and fabF polynucleotides, recombinant materials and methods for their production. In another aspect, the invention relates to methods for using such polypeptides and polynucleotides, including treatment of microbial diseases, amongst others. In a further aspect, the invention relates to methods for identifying agonists and antagonists using the materials provided by the invention, and for treating microbial infections and conditions associated with such infections with the identified agonist or antagonist compounds. In a still further aspect, the invention relates to diagnostic assays for detecting diseases associated with microbial infections and conditions associated with such infections, such as assays for detecting fabF expression or activity.
Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following descriptions and from reading the other parts of the present disclosure.
DESCRIPTION OF THE INVENTION
The invention relates to fabF polypeptides and polynucleotides as described in greater detail below. In particular, the invention relates to polypeptides and polynucleotides of a fabF of
Staphylococcus aureus
, that is related by amino acid sequence homology to fabF polypeptide. The invention relates especially to fabF having a nucleotide and amino acid sequences set out in Table 1 as SEQ ID NO:1 and SEQ ID NO:2 respectively. Note that sequences recited in the Sequence Listing below as “DNA” represent an exemplification of the invention, since those of ordinary skill will recognize that such sequences can be usefully employed in polynucleotides in general, including ribopolynucleotides.
TABLE 1
fabF Polynucleotide and PoLypeptide Sequences
(A)
Staphylococcus aureus
fabF polynucleotide sequence
[SEQ ID NO:1].
5′-
ATGAGTCAAAATAAAAGAGTAGTTATTACAGGTATGGGAGCCCTTTCTCCAATCGGTAATGATGTCAAAACA
ACATGGGA
GAATGCTCTAAAAGGCGTAAATGGTATCGATAAAATTACACGTATCGATACTGAACCTTATAGCGTTCACTT
AGCAGGAG
AACTTAAAAACTTTAATATTGAAGATCATATCGACAAAAAAGAAGCGCGTCGTATGGATAGATTTACTCAAT
ATGCAATT
GTAGCAGCTAGAGAGGCTGTTAAAGATGCGCAATTAGATATCAATGATAATACTGCAGATCGAATCGGTGTA
TGGATTGG
TTCTGGTATCGGTGGTATGGAAACATTTGAAATTGCACATAAACAATTAATGGATAAAGGCCCAAGACGTGT
GAGTCCAT
TTTTCGTACCAATGTTAATTCCTGATATGGCA
Horn Stephanie Van
Kallender Howard
Lonsdale John T
Palmer Leslie Marie
West Joshua
Allen Marianne P.
Deibert Thomas S.
Gimmi Edward R.
King William T.
SmithKline Beecham Corporation
LandOfFree
FabF from Staphylococcus aureus does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with FabF from Staphylococcus aureus, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and FabF from Staphylococcus aureus will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-2442332