Chemistry: molecular biology and microbiology – Process of mutation – cell fusion – or genetic modification – Introduction of a polynucleotide molecule into or...
Reexamination Certificate
1997-11-03
2004-08-10
Falk, Anne-Marie (Department: 1632)
Chemistry: molecular biology and microbiology
Process of mutation, cell fusion, or genetic modification
Introduction of a polynucleotide molecule into or...
C435S320100, C435S325000, C536S024100
Reexamination Certificate
active
06773919
ABSTRACT:
FIELD OF THE INVENTION
The present invention relates to DNA plasmids to be used for the production of recombinant proteins. More specifically, the present invention concerns the addition of specific DNA elements to expression plasmids that serve a function as enhancing elements. The outcome is to improve the yields of recombinant protein production.
BACKGROUND OF THE INVENTION
There are a number of different strategies for the large-scale production of recombinant proteins to be used in, for example, the pharmaceutical industry. In certain cases it is desirable that the recombinant protein is made in eucaryotic hosts. These hosts may be cultivated cells or animals made transgenic with respect to the gene of interest. In the latter situation, transgenic expression in milk is a valuable technique since transgenes, active in the mammary gland, have been described and milk is a readily available body fluid.
The present invention relates to, in an unrestricted way, an improvement in expression vectors used to produce recombinant proteins in milk. These improved expression vectors will increase the yield of valuable recombinant proteins which will be of value for the facilitation of subsequent handling and purification steps.
Construction of a transgene requires certain basic ingredients, one being the structural gene containing the coding information for the protein of interest. A basal eucaryotic gene expression promoter is also required. In addition, other sequences can be used that confer tissue specificity or enhance expression in response to stimulus. The present invention relates to a specific type of enhancers, namely enhancers responding to hormonal stimuli. The particular enhancer in question is a sequence of DNA that confers a response to signals evoked by pituitary hormones belonging to the group of lactogenic hormones such as prolactin (Prl) and placenta lactogen (PL) and somatogenic hormones such as growth hormone (GH). Both of these groups of hormones occupy central roles in the stimulation of mammary gland development and function. The present invention concerns the definition of enhancers responding to both lactogenic and somatogenic hormones and the construction of expression vectors, that, in their ability to respond to both lactogenic and somatogenic hormones, will function in an improved manner as transgenes for production of recombinant proteins in milk.
Previous studies have defined a gene, the Serine Protease Inhibitor 2.1 (SPI) gene, that responds to GH. In the 5′ flank of this gene a DNA element has been identified that enhances gene expression in a GH-dependent fashion. The sequence of this GH response element (SPI GH-RE) in question is: SEQ ID NO:1 GATCTACGCTTCTACTAATCCATGTTCTGAGAAATCATC CAGTCTGCCCATG, (Yoon et al. J. Biol. Chem. 265; 19947 (1991)) Within this sequence we now disclose a shorter “SPI-GAS like element”; TTCTGAGAA, that constitutes the core GH regulated sequence. As exemplified below the SPI-GAS element is also functional when transferred to a reporter gene such as the Luciferase gene (Sliva D. et al J. Biol.. Chem. in press). In the following we also disclose that the GH-regulated sequences described above are also regulated by prolactin and that this can be used to design new expression vectors that improve existing vectors used to produce recombinant proteins in milk.
REFERENCES:
patent: 5814517 (1998-09-01), Seidel et al.
patent: 0420055 (1991-04-01), None
patent: WO 8801648 (1988-03-01), None
patent: WO 9405796 (1994-03-01), None
Lindquester et al. Avian tropomyosin gene expression. Nucleic Acids Research 17(5): 2099-2118, 1989.*
Le Stunff et al. Contrasting acute in vivo nuclear actions of growth hormone and prolactin. Molec. and Cell. Endocrinology 121:109-117, 1996.*
Petitclerc et al. The effect of various introns and transcription terminators on the efficiency of expression vectors in various cultured cell lines and in the mammary gland of transgenic mic. J. of Biotechnol. 40:169-178, 1995.*
Sliva et al. Growth hormone specifically regulates serine protease inhibitor gene transcription via gamma-activated sequence-like DNA elements. J. Biol. Chem. 269(42):26208-26214, 10/94.*
Wall, RJ Transgenic livestock: Progress and prospects for the future. Theriogenology 45:57-68, 1996.*
Yoon et al. An inducible nuclear factor binds to a growth hormone-regulated gene. J. Biol. Chem. 265(32):19947-19954, 11/90.*
Lavenu et al. The cis-acting elements known to regulate c-myc expression ex vivo are not sufficient for correct transcription in vivo. Oncogene 9:527-536, 1994.*
Yoon et al,The Journal of Biological Chemistry, 262(9):4284-4289 (Mar. 25, 1987).
Dialog MedLine Abstract, Dialog Accession No. 06192046, MedLine Accession No. 87166046, Yoon et al,J. Biol. Chem, 262 (9), pp. 4284-4289, (1987).
LeCama et al,J. Biol. Chem., 260(34):21532-21539 (1994).
Enberg et al,J. Mol. Endocrinol., 12(81):39-46 (Feb. 1994).
Goujon et al,Proc. Natl. Acad. Sci, USA, 91:957-961 (Feb. 1994).
Enberg Bertil
Haldosen Lars-Arne
Lobie Peter
Norstedt Gunnar
Sliva Daniel
Biovitrum AB
Falk Anne-Marie
Fish & Richardson P.C.
LandOfFree
Expression vector for production of recombinant proteins does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Expression vector for production of recombinant proteins, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Expression vector for production of recombinant proteins will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-3292001