Expression systems for functional nucleic acid expression

Details Expression systems for functional nucleic acid expression Expression systems for functional nucleic acid expression

2001-02-26

2004-05-25

Lacourciere, Karen A. (Department: 1635)

Organic compounds -- part of the class 532-570 series

Organic compounds

Carbohydrates or derivatives

C435S006120, C435S091100, C435S091300, C435S325000, C435S375000

Reexamination Certificate

active

06740750

ABSTRACT:

TECHNICAL FIELD
The present invention relates to ribozymes and their expression systems.
BACKGROUND ART
A hammerhead ribozyme is one of the smallest catalytic RNA Molecules (Kruger et al., 1982; Guerrier-Takada et al., 1983). Because of its small size and potential as an antiviral agent, numerous mechanistic studies (Dahm and Uhlenbech, 1991, Dahm et al., 1993; Eckstein and Lilley, 1996; Pontius et al., 1997; Lott et al., 1998; Zhou et al., 1996, 1997; Zhou and Taira, 1998) and studies directed towards application in vivo have been performed (Erickson and Izant, 1992; Murray, 1992; Rossi, 1995; Eckstein and Lilley, 1996; Prislei et al., 1997; Turner, 1997; Scanlon, 1997). Many successful experiments, aimed at the use of ribozymes for suppression of gene expression in different organisms, have been reported (Sarver et al., 1990; Dropulic et al., 1992; Ojwang et al, 1992; Yu et al, 1993; Zhao and Pick, 1993; Inokuchi et al, 1994; Yamada et al., 1994; Ferbeyre et al, 1996; Fujita et al, 1997; Kawasaki et al, 1998). However, the efficacy of ribozymes in vitro is not necessarily correlated with functional activity in vivo. Some of the reasons for this ineffectiveness in vivo are as follows. i) Cellular proteins may inhibit the binding of the ribozyme to its target RNA or may disrupt the active conformation of the ribozyme. ii) The intracellular concentration of metal ions essential for ribozyme-mediated cleavage might not be sufficient for functional activity. iii) Ribozymes are easily attacked by RNases. However, we are now starting to understand the parameters that determine ribozyme activity in vivo (Bertrand and Rossi, 1996; Bertrand et al., 1997; Gebhard et al., 1997). Studies in vivo have suggested that the following factors are important for the effective ribozyme-mediated inactivation of genes: a high level of ribozyme expression (Yu et al., 1993); the intracellular stability of the ribozyme (Rossi and Sarver, 1990; Eckstein and Lilley, 1996); co-localization of the ribozyme and its target RNA in the same cellular compartment (Sullenger and Cech, 1993; Bertrand et al., 1997); and the cleavage activity of the transcribed ribozyme (Thompson et al., 1995). Recently, it was shown that these various features depend on the expression system that is used (Bertrand et al., 1997).
The RNA polymerase II (pol II) system, which is employed for transcription of mRNAs, and the polymerase III (pol III) system, employed for transcription of small RNAs, such as tRNA and snRNA, have been used as ribozyme expression systems (Turner, 1997). Transcripts driven by the pol II promoter have extra sequences at the 3′ and 5′ ends (for example, an untranslated region, a cap structure, and a polyA tail), in addition to the coding region. These extra sequences are essential for stability in vivo and functional recognition as mRNA. A transcript containing a ribozyme sequence driven by the pol II promoter includes all those sequences, unless such sequences are trimmed after transcription (Taira et al., 1991; Ohkawa et al., 1993). As a result, in some case, the site by which the ribozyme recognizes its target may be masked, for example, by a part of the coding sequence. By contrast, the pol III system is suitable for expression of short RNAs and only very short extra sequences are generated. In addition, expression is at least one order of magnitude higher than that obtained with the pol II system (Cotten and Birnstiel, 1989). Thus, it was suggested that the pol III system might be very useful for expression of ribozymes (Yu et al., 1993; Perriman et al., 1995). However, in many cases, the expected effects of ribozymes could not be achieved in spite of the apparently desirable features of the pol III system (Ilves et al., 1996; Bertrand et al., 1997).
DISCLOSURE OF THE INVENTION
In order to investigate the parameters that determine ribozyme activity in vivo, we designed three types of ribozyme with an identical ribozyme sequence, driven by tRNA
Val
promoter which is a pol III promoter, and demonstrated that the entire structure of the transcript (ribozyme to which the sequence of tRNA
Val
is added (hereinafter termed “tRNA
Val
-ribozyme”)) determined not only cleavage activity but also the intracellular half-life of the ribozyme. All the chimeric tRNA
Val
-ribozymes that were transcribed in the cell nucleus were exported to the cytoplasm. Thus, the ribozymes and their target were present within the same cellular compartment. Under these conditions, we found that the intracellular half-life and the steady-state level of each tRNA
Val
-ribozyme were the major determinants of functional activity in vivo. Moreover, we demonstrated that cells that expressed a specifically designed ribozyme with the longest half-life in vivo were almost completely resistant to a challenge by HIV-1. Further, by establishing a small bulge structure (“bulge” refers to, in the case where RNA adopts a hairpin structure, a portion where there is a protruding single-stranded structure of unmatched base pairs) at the amino-acyl stem portion of the tRNA
Val
structure, avoidance of recognition from the mature enzyme can be achieved and as a result, any RNA sequence comprising a ribozyme sequence connected to the 3′ end can be made to exist intracellularly in a form where it is connected to tRNA
Val
. Any RNA comprising a ribozyme sequence connected to the 3′ end of the tRNA
Val
structure of the present invention, due to the properties of the tRNA structure, is transported stably and efficiently to the cytoplasm. This is of particular importance for the intracellular function of the ribozyme.
A summary of the present invention is presented as follows:
1. A ribozyme comprising a nucleotide sequence having the following base sequence (I) or (II):
base sequence (II) (SEQ ID NO. 1): 5′-ACCGUUGGUUUCCGUAGUGU AGUGGUUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCAC UACAAACACMCACUGAUGAGGACCGAAAGGUCCGAAACGGGCACGUCGGAAACGG UUUU[[U]]-3′
base sequence (II)(SEQ ID NO. 2): 5′-ACCGUUGGUUUCCGUAGUGUAGUG GUUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCACUACM ACCMCACACMCACUGAUGAGGACCGAAAGGUCCGAAACGGGCACGUCGGAAACG GUUUU[[U]]-3′.
2. An expression vector comprising DNA encoding the ribozyme according to 1 above.
3. A method of producing the ribozyme according to 1 above comprising transcribing to RNA with expression vector DNA as a template, wherein said expression vector DNA comprises DNA encoding the ribozyme according to 1 above.
4. A pharmaceutical composition comprising the ribozyme according to 1 above or the expression vector according to 2 above, as an effective ingredient.
5. The pharmaceutical composition according to 4 above for the prevention and/or treatment of acquired immune deficiency syndrome.
6. A method of specifically cleaving a target RNA using the ribozyme according to 1 above.
7. The method of 6 above wherein the target RNA is HIV-1 RNA.
8. An RNA variant (mature tRNA
Val
) adopting the following secondary structure (I), wherein said RNA variant comprises a bulge structure introduced in the region in which hydrogen bonds form between nucleotides 8 to 14 and nucleotides 73 to 79.
9. The RNA variant of 8 above wherein a bulge structure is introduced by substituting all or part of the sequence of the region corresponding to nucleotides 73 to 79 within a nucleotide sequence of an RNA adopting secondary structure (I).
10. The RNA variant according to 8 above consisting of the sequence of a region corresponding to nucleotides 1-80 within a nucleotide sequence represented by SEQ ID NO: 1.
11. The RNA variant according to 8 above consisting of the sequence of a region corresponding to nucleotides 1-86 within a nucleotide sequence represented by SEQ ID NO: 2.
12. An RNA comprising the RNA variant of 8 above and a selected RNA chain linked thereto.
13. The RNA according to 12 above wherein selected RNA chain is a ribozyme or an antisense RNA.
14. The RNA according to 12 above wherein a bulge structure is formed with any nucleotide of an RNA chain linked t

Affiliated with

Also associated with

Rating

Expression systems for functional nucleic acid expression does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Expression systems for functional nucleic acid expression, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Expression systems for functional nucleic acid expression will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-3271201