Chemistry: molecular biology and microbiology – Measuring or testing process involving enzymes or... – Involving nucleic acid
Reexamination Certificate
1999-05-20
2001-08-28
Patterson, Jr., Charles L. (Department: 1652)
Chemistry: molecular biology and microbiology
Measuring or testing process involving enzymes or...
Involving nucleic acid
C435S091100, C435S190000
Reexamination Certificate
active
06280942
ABSTRACT:
FIELD OF THE INVENTION
The present invention relates to a site-specific endonuclease which recognizes a specific nucleotide sequence, to a gene coding for the endonuclease, to a recombinant vector containing the gene, to a transformant containing the vector, and to a process for producing the endonuclease.
BACKGROUND OF THE INVENTION
Endonuclease is a nuclease (nucleic acid degrading enzyme) which hydrolyzes the phosphodiester bond of a polynucleotide chain. Endonuclease recognizes and binds to a specific nucleotide sequence along DNA molecules, whereby molecules within the recognition sequence is cut. Endonuclease is a requisite enzyme for today's advanced gene engineering techniques for cloning and analyzing genes.
A site-specific endonuclease Endo.SceI (hereinafter, also referred to as “SceI”) from an eucaryotic microorganism (e.g., yeast) is known to be a heterodimer having subunits of 75 kDa and 50 kDa. The subunits of SceI as well as genes encoding the subunits have been cloned, and the nucleotide sequences thereof have been determined (for 75 kDa subunit, see Morishima, N. et al., J. Biol. Chem. 265, 15189-15197 (1990) and for 50 kDa subunit, see JP-B-7-77556).
In order to widely utilize the above-described endonuclease for artificially modifying a biochemical agent, a gene or the like, the endonuclease needs to be mass-produced with a gene expression system. The endonuclease does not function unless it recognizes a specific nucleotide sequence, i.e., the endonuclease needs to be specific to the nucleotide sequence to be recognized.
The 50 kDa subunit of the above-described endonuclease SceI is encoded by mitochondrial genomes of yeast (
Saccharomyces cerevisiae
). A gene of a mitochondrial genome of yeast contains codons unique to mitochondria which are different from amino acid codons (universal codons) used in gene expression systems from organisms generally used for mass expression of protein (
E.coli
, baculovirus, yeast, etc.). If this gene of the mitochondrial genome is directly used, the protein expression system hardly produces a protein of an original amino acid sequence. For example, while TGA is a stop codon as a universal codon, it is a different codon coding for other amino acid (Trp) in mitochondria. A gene may be normally expressed in mitochondria but expression of the same gene may not result in a complete protein in a general expression system such as
E.coli
due to incomplete translation caused by the stop codon.
SUMMARY OF THE INVENTION
The present invention aims at providing a site-specific endonuclease which recognizes a specific nucleotide sequence, to a gene coding for the endonuclease, to a recombinant vector containing the gene, to a transformant containing the vector, and to a process for producing the endonuclease.
The present inventors have gone through intensive studies to solve the above-described problems. As a result, they succeeded in producing a modified endonuclease capable of recognizing and cleaving a specific nucleotide sequence by substituting, in a gene encoding an amino acid sequence of the smaller subunit of an endonuclease from yeast, codons unique to mitochondria with universal codons, and in mass-expressing the endonuclease, whereby the present invention was accomplished.
Accordingly, the present invention relates to an endonuclease capable of recognizing the nucleotide sequence: GCCCAGACATATCCCTGAATGATACC.
Further, the present invention relates to a recombinant protein of either (a) or (b):
(a) a protein comprising the amino acid sequence represented by SEQ ID NO:3; or
(b) a protein having an endonuclease activity for recognizing the nucleotide sequence: GCCCAGACATATCCCTGAATGATACC, the protein comprising at least one deletion, substitution or addition of amino acid in the amino acid sequence represented by SEQ ID NO:3.
Moreover, the present invention relates to a gene encoding the recombinant protein of either (a) or (b):
(a) a protein comprising the amino acid sequence represented by SEQ ID NO:3; or
(b) a protein having an endonuclease activity for recognizing the nucleotide sequence: GCCCAGACATATCCCTGAATGATACC, the protein comprising at least one deletion, substitution or addition of amino acid in the amino acid sequence represented by SEQ ID NO:3.
In addition, the present invention relates to a gene containing DNA of either (c) or (d):
(c) DNA comprising the nucleotide sequence represented by SEQ ID NO:2; or
(d) DNA encoding a protein having an endonuclease activity for recognizing the nucleotide sequence: GCCCAGACATATCCCTGAATGATACC, the DNA being capable of hybridizing with DNA which comprises the nucleotide sequence represented by SEQ ID NO:2 under stringent conditions.
Furthermore, the present invention relates to a recombinant vector comprising the above-described gene.
Additionally, the present invention relates to a transformant comprising the above-described recombinant vector.
Moreover, the present invention relates to a process for producing the endonuclease, comprising the steps of:
culturing the above-described transformant; and
recovering from the culture an endonuclease capable of recognizing the nucleotide sequence: GCCCAGACATATCCCTGAATGATACC.
This specification includes part or all of the contents as disclosed in the specification and/or drawings of Japanese Patent Application No. 10-141861 which is a priority document of the present invention.
REFERENCES:
patent: 4-104793 (1992-04-01), None
Nakagawa, K., et al. (1991) J. Biol. Chem. 266(3), 1977-1984.*
Seraphin, B., et al. (1987) J. Biol. Chem. 262(21), 10146-10153.*
Colleaux, L., et al.(1986) Cell 44, 521-533.*
Sutherland et al., “Multisite oligonucleotide-mediated mutagenesis: Application to the conversion of a mitochondrial gene to universal genetic code,” Biotechniques, Eaton Publishing, Natick, US, vol. 18, No. 3 (1995) pp. 458, 460, 463-464.
Mizamura et al., “Stable association of 70-kDa heat shock protein induces latent multisite specificity of a unisite-specific endonuclease in yeast mitochondria,” The Journal of Biological Chemistry, vol. 274, No. 36 (1999) pp. 25682-25690.
Mizumura Hikaru
Morishima Nobuhiro
Shibata Takehiko
Fish & Richardson P.C.
Institute of Physical and Chemical Research
Patterson Jr. Charles L.
LandOfFree
Endonuclease does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Endonuclease, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Endonuclease will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-2501413