DNA oligomers for use in detection of campylobacter pylori and m

Details DNA oligomers for use in detection of campylobacter pylori and m DNA oligomers for use in detection of campylobacter pylori and m

1994-04-14

1996-11-05

Zitomer, Stephanie W.

Chemistry: molecular biology and microbiology

Measuring or testing process involving enzymes or...

Involving nucleic acid

435 912, 935 77, 935 78, C12P 1934, C12Q 168

Patent

active

055716741

ABSTRACT:
This invention provides a DNA oligomer having the sequence 5'GGACATAGGCTGATCTCTTAGC3' (SEQ ID NO: 1) and which is complementary to Campylobacter pylori 16S ribosomal RNA sequences, for use as a probe to detect Campylobacter pylori.
This invention also provides DNA oligomers having the sequences 5'GCGCAATCAGCGTCAGGTAATG3' (SEQ ID NO: 2) and 5'GCTAAGAGATCAGCCTATGTCCC3' (SEQ ID NO: 3) and which are complementary to certain Campylobacter pylori 16S ribosomal RNA sequences, for use as polymerase chain reaction primers for the detection of Campylobacter pylori.
This invention also provides a method for producing species-specific bacterial or protozoan DNA oligomers encoding 16S ribosomal RNA by means of the polymerase chain reaction for use as species-specific probes and PCR primers, and methods for detection and identification of bacteria and protozoa.
Further, this invention provides a DNA oligomer having the sequence 5'ACGGGCGGTGTGTGC3' (SEQ ID NO: 4).

REFERENCES:
patent: 4683195 (1987-07-01), Mullis et al.
patent: 4851330 (1989-07-01), Kohne
Olwe et al., Molecular & Cellular Probes 2:47-57 (1988).
Romanwk et al., J. Bact. 169(5);2137-2141 (May 1987).

Affiliated with

Also associated with

Rating

DNA oligomers for use in detection of campylobacter pylori and m does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with DNA oligomers for use in detection of campylobacter pylori and m, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and DNA oligomers for use in detection of campylobacter pylori and m will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-2014220