Chemistry: molecular biology and microbiology – Measuring or testing process involving enzymes or... – Involving nucleic acid
Reexamination Certificate
1999-06-10
2001-09-18
Fredman, Jeffrey (Department: 1655)
Chemistry: molecular biology and microbiology
Measuring or testing process involving enzymes or...
Involving nucleic acid
C435S091200, C536S023100
Reexamination Certificate
active
06291174
ABSTRACT:
The present invention relates to methods of screening pigs to determine the presence or absence of alleles of the Follicle-Stimulating hormone &bgr; subunit gene associated with increased litter size, to the use of such methods in predicting litter size in pigs and to kits for carrying out such methods.
Meat production and animal breeding efficiencies could be improved if it were possible to increase animal litter sizes. The same output of livestock could be derived from fewer parent animals, thus providing decreased production costs. In addition, animal breeding organizations would benefit from the potential to screen more offspring for those with improved genetics. However, litter size is very difficult to select for conventionally, as it is limited to one sex and is heavily influenced by non-genetic factors (heritability, a measure of the fraction of the phenotypic variation that is due to genetic differences, is approximately 0.1 for litter size in the pig).
One approach to improving litter size might be to introduce beneficial genes into production lines from breeds which have significantly higher litter sizes. However, quantitative genetics suggests that complex traits such as litter size are controlled by a large number of genes each having a small effect on the trait. If this is true, genetic progress through selection of complex traits is likely to be very slow. An alternative view is that, although many genes are involved in complex traits, a few of the genes involved (major genes) have large effects on the trait. If this alternative view is true, then genetic progress of such traits could be rapid, provided that it is possible to identify and select for beneficial alleles of relevant major genes. Since the advent of genome mapping, it has become possible to identify genes affecting quantitative traits (quantitative trait loci, QTL) by looking for associations between the trait and molecular markers distributed evenly across the genome of animals for which maps are available. Importantly, for selection purposes, the heritability of such marker phenotypes is 1.0.
The Chinese Meishan breed of pig is known to produce about 4 extra piglets per litter than the most prolific European breeds. Genes for prolificacy (litter size) from this breed would be of great value in programmes aimed at increasing the litter size of commercial Western pig breeds. Indeed a genetic marker associated with the oestrogen receptor gene (ESR) of the Meishan has been shown to have beneficial effects on litter size and is described in WO92/18651. In addition, in WO96/41892 there were disclosed methods for testing pigs for alleles of the Osteopontin gene associated with larger litter size in pigs.
We have now characterised a polymorphism in the porcine FSH &bgr;-subunit gene and have established that the polymorphism is associated with litter size in pigs.
Mammalian follicle stimulating hormone (FSH) is a glycoprotein composed of two subunits, an &agr;-subunit (which is also common to other glycoprotein hormones such as LH and TSH) and a unique &bgr;-subunit. The sequence of the B-subunit was reported by Hirai, et al.,
J. Mol. Endocrinol.,
5:147-158 (1990) and is available under Genbank accession No. D00621, Locus “PIGFSHBS”. In general, FSH is secreted from the anterior pituitary under the stimulation of GnRH and reaches target tissue in the gonads via the blood. It interacts with its receptor on granular cells, promoting the maturation and differentiation of ovarian follicles. FSH and LH play an important role in the development of the oocyte before fertilization.
The present inventors have determined that there is a mutation in the FSH &bgr;-subunit gene in certain pig breeds which results from the insertion of a retroposon, which contains a complete promoter for RNA polymerase II as well as other possible transcription regions. Litter sizes in pigs carrying the mutation are significantly different from those of pigs lacking the mutation.
Thus, in a first aspect the present invention provides a method for screening pigs to determine those more likely to produce larger litters, and/or those less likely to produce larger litters, by determining whether the pigs carry the FSH &bgr; mutation. In one mode this method comprises the steps:
(i) obtaining a sample of pig nucleic acid; and
(ii) analysing the nucleic acid obtained in (i) to determine which FSH &bgr;-subunit allele(s) is/are present.
Suitably, the nucleic acid is a sample of pig nucleic acid and step (ii), namely the determination of FSH &bgr;-subunit alleles, is carried out by looking for particular DNA markers linked either directly or indirectly to the FSH &bgr;-subunit gene.
Association between genetic markers and genes responsible for a particular trait can be disrupted by genetic recombination. Thus, the closer the physical distance between the marker and the gene in question, the less likely it is that recombination will separate them. It is also possible to establish linkage between specific alleles of alternative DNA markers and alleles of DNA markers known to be associated with a particular gene (e.g. the FSH &bgr;-subunit gene discussed herein), which have previously been shown to be associated with a particular trait. In a further embodiment of the invention a number of such markers are used. For example, pairs of markers might be utilised to bracket the major gene to reduce any possible effects of recombination.
As discussed above, the mutation described herein consists of the insertion of a retroposon. The presence of the retroposon is associated with smaller litter size. The retroposon is located at the border of Intron I and Exon II of the FSH &bgr;-subunit gene, at 809 bp (with the transcription start site labelled 0), and is 292 bp in length This retroposon has the sequence:
GGAGTTCCCCGTCGTGGCGCAGTGGTTAACGAATCCGATTAGGAACC
(SEQ ID NO:1)
ATGAGGTTGCGGGTTCGGTCCCTGCCCTTGCTCAGTGGGTTAATGATC
CGGCGTTGCATGAGCTGTGGTGTAGGTTGCAGACGAGGCTCGGATCCC
CGCGTTGCTGTGGTTTCTGGCGTAGGCGGGTGGCTACAGTTTTGATTC
GACCCCTAGCCTGGGAACCTCCATATGCCGCGGGAGCGCCCAAAGAA
ATGGCAAAAGACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAACGTTT
The sequence of the retroposon together with a portion of the 5′ and 3′ flanking sequence is as follows, where upper case represents the retroposon sequence and lower case represents flanking sequence:
5′ttggagtttccatcgtgggcgcaatggttaacgaatcgactaggaaccaagaggttgcgggttcgatccctggcctt
(SEQ ID NO:2)
gctcagtgggttaaggatccagcattgctgtgagctgtggtgtaggttacagacacagcttggatcccacgttgctgtg
gccctggcatagggcgatggctacagctctgattagacccctagccttggaaactccatatgccaagggagcagtcc
aagaaatggcaaaaagaccaaaaaaaaagtttttctttttaaataaaatgttttaaaatgataatgaagggacaaatatgat
gatcacaattacttgcttcagagtaatcctttaagacagtcaatggcaatactctataaatattgctctgcttcaaaacattat
attggagttttgacccataatatagttctactttgacaaaaaaaaaaaaaattgaggaggagaataagaagaaacgtttt
GGAGTTCCCCGTCGTGGCGCAGTGGTTAAACGAATCCGATTAGGAAC
CATGAGGTTGCGGGTTCGGTCCCTGCCCTTGCTCAGTGGGTTAATGAT
CCGGCGTTGCATGAGCTGTGGTGTAGGTTGCAGACGAGGCTCGGATCC
CCGCGTTGCTGTGGTTTCTGGCGTAGGCGGGTGGCTACAGTTTTGATT
CGACCCCTAGCCTGGGAACCTCCATATGCCGCGGGGAGCGCCCAAAG
AAATGGCAAAAGACAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAGAAACGTTTgttcaagaaacaaagaattaaagaaaaggaaaaggaaggaaaaaccactataggagta
aaatgtgactggagaggatgaatagaccagttattcaaggtttggtcaacttacattacgaatgtaattctttggttttttca
gttttttacaggccttaattgtttggtttccaccccaagatgaagtcgcgtgcagttttgcttcctattctgttgctggaaacc
atctgctgcaatagctgtgagctgaccaacatcaccatcacagtggagaaagaggagtgtaacttctgcataagcatca
acaccacgtggtgtgctggctattgctacacccgggtaggttctttgctttgctagaagtgagggtgctgaaggtctgta
aaaggcgggctttactaattcccc-3′
Thus, in one embodiment of the first aspect of the invention, step (ii) consists of analysing the nucleic acid to determine the presence and/or absence of the retroposon. The skilled person will appreciate that this can be achieved using suitable probes, which may be labelled for instance, which would bind to at least a part of the retroposon sequence. Alternatively, PCR amplification of the nucleic acid can be carried out. Methods for amplification are well known in the art (see e
Li Ning
Wu Changxin
Zhao Yaofeng
Brobeck Phleger & Harrison LLP
Einsmann Juliet
Fredman Jeffrey
Pig Improvement Company UK Limited
LandOfFree
DNA markers for pig litter size does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with DNA markers for pig litter size, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and DNA markers for pig litter size will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-2442564