Chemistry: molecular biology and microbiology – Micro-organism – tissue cell culture or enzyme using process... – Preparing compound containing saccharide radical
Reexamination Certificate
2001-05-15
2003-09-30
Salimi, Ali R. (Department: 1648)
Chemistry: molecular biology and microbiology
Micro-organism, tissue cell culture or enzyme using process...
Preparing compound containing saccharide radical
C435S091200, C435S091330, C424S204100, C536S023720
Reexamination Certificate
active
06627418
ABSTRACT:
TECHNICAL FIELD
The present invention relates to methods for detecting viral pathogens, particularly human herpes virus 6 (HHV6), using polymerase chain reaction (PCR) techniques.
BACKGROUND ART
Cytomegalovirus (CMV) shedding and disease are classically associated with immunosuppressive therapy following organ transplantation in two distinct settings. Primary disease, often with organ involvement usually occurs within the first 6 weeks. The less severe secondary disease, two to three months after transplantation may be caused by reactivation or reinfection with CMV. Biological anti-rejection therapy, however, including OKT3 and anti-thymocyte globulins (ATG), is now the major risk factor for CMV disease in the CMV seropositive patient.
Other herpesviruses, including human herpes virus 6 (HHV6), reactivate during periods of intense immunosuppression. Infection with HHV6 is usual in the first one to three years of life and a minority develop exanthem subitum during primary infection. HHV6 antibody levels tend to decrease in adults over 30 years of age and may reach undetectable levels. Two major subspecies of HHV6, variants A and B, have been distinguished on genetic, antigenic and biological characteristics. Reactivation of HHV6 (variant B) has been reported in bone marrow, renal and liver transplant patients and has been associated with hepatitis, severe interstitial pneumonitis and encephalitis. Serologic evidence has been reported for simultaneous reactivation of CMV and HHV6 after renal transplantation and there have been reports of dual infection with CMV and either HHV6 or HHV7 in transplant patients. Prospective studies of the role of HHV6 in febrile disease following renal transplantation and the potential interaction between CMV and HHV6 reactivation in causing disease are lacking.
Viral markers which can accurately predict CMV/HHV6 disease, the need for antiviral therapy, and likelihood of successful response in renal transplant recipients is an important clinical priority. Buffy coat cultures have been a more reliable predictor of CMV disease in renal transplantation than detection in urine. More recently, detection of CMV DNA in plasma or quantification in urine or buffy coat have been shown to be predictive of disease in liver, renal transplant or HIV infected patients. HHV6 DNA has been detected in sera from immunosuppressed patients with HIV infection or undergoing bone marrow transplantation. The present inventors have examined prospectively reactivation or infection with CMV and HHV6 detected as viral DNA by polymerase chain reaction (PCR) in serum and urine, to determine the relative contributions of the two viruses towards disease during renal transplantation and to consider whether active infection of both viruses together may predict either the frequency or severity of disease.
The present inventors have detected an association between viral infections and have developed new methods to detect and differentiate viral infections in organ transplant and immunocompromised patients.
DISCLOSURE OF INVENTION
In a first aspect, the present invention consists in an isolated nucleic acid molecule complementary to and specific for human herpes virus 6 (HHV6) DNA including a sequence selected from the group consisting of 5′CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO: 1), 5′ACAAGTTGCCATTTCGGGGAAGTAC (SEQ ID NO: 2), and functionally equivalent sequences.
In a preferred embodiment of the present invention, the molecule consists of the sequence 5′CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO: 1), 5′ACAAGTTGCCATTTCGGGGAAGTAC (SEQ ID NO: 2), or a functional equivalent of either one of these sequences.
A functionally equivalent sequence is defined as a sequence being different by one or more bases but still specific for and able to bind to the DNA of HHV6.
In a second aspect, the present invention consists in a method for amplifying HHV6 DNA which method involves the use of a pair of oligonucleotide primers comprising the sequences 5′CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO: 1)and 5′ACAAGTTGCCATTTCGGGGAAGTAC (SEQ ID NO: 2), or including functionally equivalent sequences. Preferably, the primers consist of the sequences 5′CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO: 1)and 5′ACAAGTTGCCATTTCGGGGAAGTAC (SEQ ID NO: 2), or functionally equivalent sequences.
In a third aspect, the present invention consists in a method of detecting HHV6 in a sample containing HHV6, the method comprising the steps of:
(a) optionally, amplifying viral DNA present in the sample by polymerase chain reaction techniques using outer primers complimentary to the viral DNA;
(b) adding to the sample, or to the sample having undergone optional amplification step (a), a pair of inner oligonucleotide primers complementary to and specific for HHV6 DNA, wherein the inner primers include the sequences 5′AAGCTTGCACAATGCCAAAAAACAG (SEQ ID NO: 3) and 5′CTCGAGTATGCCGAGACCCCTAATC (SEQ ID NO: 4), or functionally equivalent sequences;
(c) carrying out polymerase chain reaction techniques on the sample so as to amplifying the HHV6 DNA spanned by the inner primers present in the sample; and
(d) detecting the amplified HHV6 DNA.
In a preferred embodiment of the third aspect of the present invention, the method comprises the steps of:
(a) optionally, amplifying viral DNA present in the sample by polymerase chain reaction techniques by
(i) adding outer primers, complimentary to the viral DNA in the sample,
(ii) providing buffers, reagents, nucleotides and a thermostable DNA polymerase to the sample to form a reaction mixture,
(iii) heating the reaction mixture to a temperature such that double stranded viral DNA present denatures to form single stranded DNA molecules,
(iv) cooling the reaction mixture to a temperature such that the outer primers anneal to their respective complementary sequences on the denatured single stranded DNA molecules,
(v) heating the reaction mixture to a temperature such that the DNA polymerase extends the primers to form new double stranded DNA molecules spanning the region of DNA defined by the outer primers, and
(vi) repeating steps (iii), (iv) and (v) such that the number of copies of the region of DNA encoding the double stranded viral DNA is amplified;
(b) adding to the optionally amplified sample a pair of inner oligonucleotide primers complementary to and specific for HHV6 DNA, wherein the inner primers include the sequences 5′AAGCTTGCACAATGCCAAAAAACAG (SEQ ID NO: 3)and 5′CTCGAGTATGCCGAGACCCCTAATC (SEQ ID NO: 4), or functionally equivalent sequences;
(c) heating the reaction mixture to a temperature such that the optionally amplified double stranded viral DNA denatures to form single stranded DNA molecules;
(d) cooling the reaction mixture to a temperature such that the inner primers anneal to their respective complementary sequences on the denatured DNA;
(e) heating the reaction mixture to a temperature such that the DNA polymerase extends the primers to form new double stranded DNA molecules spanning the region of DNA defined by the inner primers;
(f) repeating steps (c), (d) and (e) such that the number of copies of the region of DNA is amplified; and
(g) detecting the amplified DNA.
The sample can be any sample including fixed or frozen tissue samples, and any biological fluid including blood, serum, urine, semen, sputum, saliva, cerebrospinal spinal fluid, cord blood and other excretions. Preferably, the sample is serum or urine. The same can be pre-treated to extract or concentrate the nucleic acid material (DNA) from the sample by standard methods known in the art. Outer primers comprising the sequences 5′CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO: 1) and 5′ACAAGTTGCCATTTCGGGGAAGTAC (SEQ ID NO: 2) have been found to be particularly suitable for the optional steps of amplifying viral DNA in the sample. More preferably, the outer primers consist of the sequences 5′CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO: 3)and 5′ACAAGTTGCCATTTCGGGGAAGTAC (SEQ ID NO: 2).
Preferably, the inner primers consist of the sequences 5′CTTCTGTTTTAAG
Cunningham Anthony Lawrence
Ratnamohan Vigneswary Mala
Nixon & Vanderhye
Salimi Ali R.
Westmead Institute of Health Research
LandOfFree
Detection of human herpes virus 6 (HHV6) does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Detection of human herpes virus 6 (HHV6), we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Detection of human herpes virus 6 (HHV6) will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-3033537