Detection of C4A deletion by long range PCR

Details Detection of C4A deletion by long range PCR Detection of C4A deletion by long range PCR

1999-12-23

2001-05-01

Fredman, Jeffrey (Department: 1655)

Chemistry: molecular biology and microbiology

Micro-organism, tissue cell culture or enzyme using process...

Preparing compound containing saccharide radical

C536S023400, C536S024310

Reexamination Certificate

active

06225093

ABSTRACT:

BACKGROUND OF THE INVENTION
Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by immune dysregulation resulting in the production of anti-nuclear antibodies, the generation circulating immune complexes, and the activation of the complement system. SLE leads to inflammation of various parts of the body, especially the skin, joints, blood, kidneys, lungs heart and nervous system. SLE affects approximately 1 in every 500 Americans, and strikes women 10-15 times more frequently than men. It is more common among Asians, and in China, SLE may be even more common than rheumatoid arthritis.
Although there is evidence of genetic etiology, linkage analysis suggests that there are no ‘major’ susceptibility genes segregating in families with SLE (Shai, R., et al.,
Hum. Mol. Genet.
8:639-644 (1999)). Nevertheless, a number of studies have demonstrated an association between SLE and certain major histocompatibility complex (MHC) antigens (Fielder, A. H. et al.,
Br. Med J.
(
Clin. Res. Ed.
)286(6363):425-8 (1983); Christiansen, F. T. et al.,
Aust. NZ J. Med.
13(5):483-8 (1983); Reveille, J. D. et al.,
Immunogenetics
21(4):299-311 (1985); Howard, P. F. et al.,
Am. J. Med.
81(2):187-193 (1986); Kemp, M. E. et al.,
Arthritis Rheum.
30(9):1015-1022 (1987)). Within the MHC region, found on the short arm of chromosome 6, are the genes for the fourth component of the complement system: C4A and C4B. These genes are highly homologous, with only an 8 nucleotide difference in exon 26. This difference leads to six amino acid changes which allow resolution on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Belt, K. T., et al.,
Cell
36(4):907-914 (1984)).
HLA-DR3 and a C4A null allele are frequently co-inherited as the extended haplotype B8,BfS:C2C,C4AQ0,C4B1;DR3. This is the most common extended haplotype in white SLE patients (Kemp, M. E. et al.,
Arthritis and Rheumatism
30:1015-22 (1987)). Several C4AQ0-containing haplotypes have a DNA deletion of approximately 30 kB, extending from the 5′ end of the C4A gene to the same position in the C4B gene. This deletion has been classically identified using Southern blotting, and has been found to be a genetic marker for SLE (Kemp, M. E. et al.,
Arthritis and Rheumatism
30:1015-22 (1987)). Southern blotting, however, is a time consuming and labor intensive process.
SUMMARY OF THE INVENTION
The invention pertains to methods of identifying a deletion in the C4A gene which extends from the 5′ end of the C4A gene to the same position in the C4B gene, and which serves as a marker for systemic lupus erythematosus (SLE). The deletion, referred to herein as “C4AQ0,” is an approximately 30 kb deletion that is associated with the extended haplotype B8,BfS:C2C,C4AQ0,C4B1;DR3, which is the most common extended haplotype in white SLE patients (Kemp, M. E. et al.,
Arthritis and Rheumatism
30:1015-22 (1987)). The methods can be used to determine whether an individual is at risk for developing systemic lupus erythematosus, as the presence of C4AQ0 correlates with a risk of developing systemic lupus erythematosus. The methods can additionally be used to determine the C4A deletion genotype of an individual (e.g., whether an individual is homozygous for C4AQ0; heterozygous for C4AQ0; or homozygous for the absence of C4AQ0).
In one embodiment of the methods, a test sample of genomic DNA is subjected to long range polymerase chain reaction amplification of target DNA that includes a retroviral insert in intron 9 of the C4A gene, using primers that are designed such that if the genomic DNA comprises a deletion in the C4A gene, PCR products are formed, and if the genomic DNA comprising a deletion in the C4A gene, no PCR products are formed. The presence or absence of PCR products is indicative of the presence or absence of a deletion in the C4A gene. In a preferred embodiment, the primers include a forward primer that corresponds to a DNA sequence in the G11 gene (e.g., TCTAGCTTCAGTACTTCCAGCCTGT (SEQ ID NO:1)), and a reverse primer corresponding to a DNA sequence in exon 10 of the C4A gene (e.g., GATGACACAAAATACCAGGATGTGA (SEQ ID NO:2)); these primers yield PCR products of approximately 5.4 kb in the presence of C4AQ0, and yield no detectable PCR products in the absence of C4AQ0(i.e., in the absence of the deletion in the C4A gene).
In a second embodiment of the invention, a test sample of genomic DNA is subjected to long range polymerase chain reaction amplification of target DNA that includes the junction between intron 9 and the retroviral insert in intron 9 of the C4A gene, using primers that are designed such that if the genomic DNA comprises a deletion in the C4A gene, no PCR products are formed, and if the genomic DNA comprising a deletion in the C4A gene, PCR products are formed. The presence or absence of PCR products is indicative of the absence or presence of the deletion in the C4A gene. In a preferred embodiment, the primers include a forward primer that corresponds to a DNA sequence in the G11 gene (e.g., TCTAGCTTCAGTACTTCCAGCCTGT (SEQ ID NO:1)), and a reverse primer corresponding to the junction between intron 9 and the retroviral insert in intron 9 of the C4A gene (e.g., TGGTCCCCAACATGTCTGTGCATGCTG (SEQ ID NO:3)); these primers yield PCR products of approximately 5.2 kb in the absence of C4AQ0 (i.e., in the absence of the deletion in the C4A gene), and yield no detectable PCR products in the presence of C4AQ0.
Alternatively, in another embodiment of the invention, the primers for the long range polymerase chain reaction amplification are designed such that PCR products having detectably different sizes are produced in the presence and in the absence of C4AQ0; an assessment of the size of the PCR products indicates whether C4AQ0 is present or absent.
The methods of the invention are simple to perform, provide consistent results, and can be adapted for high-throughput screening of test samples. In addition, the methods facilitate genotyping of individuals, thereby affording a quick and reliable means for identification of individuals at risk for inheriting or for developing systemic lupus erythematosus.


REFERENCES:
patent: 4683195 (1987-07-01), Mullis et al.
patent: 4683202 (1987-07-01), Mullis
patent: 4800159 (1989-01-01), Mullis et al.
patent: 4965188 (1990-10-01), Mullis et al.
patent: 5512462 (1996-04-01), Cheng
Andersson, G. et al., “Retroelements in the Human MHC Class II Region,”Trends Genet.,14(3):109-114 (1998).
Arnett, F.C. and Moulds, J.M., “HLA Class III Molecules and Autoimmune Rheumatic Diseases,”Clin. Exp. Rheumatol.,9(3):289-296 (1991).
Babon, J.J., et al., “Improved Strategy for Mutation Detection—A Modification to the Enzyme Mismatch Cleavage Method,”Nucl. Acids Res.,23(4):5082-5084 (1995).
Barba, G.M.R., et al., “A New PCR-based Typing of the Rodgers and Chido Antigenic Determinants of the Fourth Component of Human Complement,”Eur. J. Immunogenetics,21(5):325-339 (1994).
Belt, K.T., et al., “The Structural Basis of the Multiple Forms of Human Complement Component C4,”Cell,36(4):907-914 (1984).
Burland, V. and Kusukawa, N., “Long PCR Facilitates Concise Cloning and Sequencing with a Minimal Tiling Set of Templates,”Biotechniques,23(6):1070-1075 (1997).
Cheng, S., et al., “Effective Amplification of Long Targets from Cloned Inserts and Human Genomic DNA,”Proc. Natl. Acad. Sci. USA,91(12):5695-5699 (1994).
Chu, X., et al., “Length Polymorphism of the Human Complement Component C4 Gene is Due to an Ancient Retroviral Integration,”Exp. Clin. Immunogenet.,12:74-81 (1995).
Christiansen, F.T., et al., “Complement Allotyping in SLE: Association with C4A Null,”Aust. NZ J. Med.,13(5):483-488 (1983).
Curran, M.D., et al., “Long-range PCR Amplification as an Alternative Strategy for Characterizing Novel HLA-B Alleles,”European J. Immonogenet.,23(4):287-309 (1996).
Dangel, A.W., et al., “The Dichotomous Size Variation of Human Complement C4 Genes is Mediated by a Novel Family of Endogenous Retroviruses, Which Also Establishes Species-specific Genomic Patterns Among Old World Primates,”I

Affiliated with

Also associated with

Rating

Detection of C4A deletion by long range PCR does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Detection of C4A deletion by long range PCR, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Detection of C4A deletion by long range PCR will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-2523371