def1

Details def1 def1

1997-12-15

2001-09-04

Minnifield, Nita (Department: 1645)

Organic compounds -- part of the class 532-570 series

Organic compounds

Carbohydrates or derivatives

C536S023200, C536S025200, C536S023700, C536S024320, C435S320100, C435S173300, C435S252300, C435S069100, C435S325000, C435S253400, C435S242000

Reexamination Certificate

active

06284878

ABSTRACT:

FIELD OF THE INVENTION
This invention relates to newly identified polynucleotides and polypeptides, and their production and uses, as well as their variants, agonists and antagonists, and their uses. In particular, the invention relates to novel polynucleotides and polypeptides of the polypeptide deformylase family, hereinafter referred to as “def1”.
BACKGROUND OF THE INVENTION
The Streptococci make up a medically important genera of microbes known to cause several types of disease in humans, including, for example, otitis media, conjunctivitis, pneumonia, bacteremia, meningitis, sinusitis, pleural empyema and endocarditis, and most particularly meningitis, such as for example infection of cerebrospinal fluid. Since its isolation more than 100 years ago, Streptococcus pneumoniae has been one of the more intensively studied microbes. For example, much of our early understanding that DNA is, in fact, the genetic material was predicated on the work of Griffith and of Avery, Macleod and McCarty using this microbe. Despite the vast amount of research with
S. pneumoniae
, many questions concerning the virulence of this microbe remain. It is particularly preferred to employ Streptococcal genes and gene products as targets for the development of antibiotics.
The frequency of
Streptococcus pneumoniae
infections has risen dramatically in the past few decades. This has been attributed to the emergence of multiply antibiotic resistant strains and an increasing population of people with weakened immune systems. It is no longer uncommon to isolate
Streptococcus pneumoniae
strains which are resistant to some or all of the standard antibiotics. This phenomenon has created a demand for both new anti-microbial agents, vaccines, and diagnostic tests for this organism.
Clearly, there exists a need for factors, such as the def1 embodiments of the invention, that have a present benefit of being useful to screen compounds for antibiotic activity. Such factors are also useful to determine their role in pathogenesis of infection, dysfunction and disease. There is also a need for identification and characterization of such factors and their antagonists and agonists to find ways to prevent, ameliorate or correct such infection, dysfunction and disease.
Certain of the polypeptides of the invention possess amino acid sequence homology to a known fms,pdf,def protein.
SUMMARY OF THE INVENTION
It is an object of the invention to provide polypeptides that have been identified as novel def1 polypeptides by homology between the amino acid sequence set out in Table 1 [SEQ ID NO: 2 or 4] and a known amino acid sequence or sequences of other proteins such as fms,pdf,def protein.
It is a further object of the invention to provide polynucleotides that encode def1 polypeptides, particularly polynucleotides that encode the polypeptide herein designated def1.
In a particularly preferred embodiment of the invention the polynucleotide comprises a region encoding def1 polypeptides comprising a sequence set out in Table 1 [SEQ ID NO:1 or 3] which includes a full length gene, or a variant thereof.
In another particularly preferred embodiment of the invention there is a novel def1 protein from
Streptococcus pneumoniae
comprising the amino acid sequence of Table 1 [SEQ ID NO:2 or 4], or a variant thereof. A further aspect of the invention there are provided isolated nucleic acid molecules encoding def1, particularly
Streptococcus pneumoniae
def1, including mRNAs, cDNAs, genomic DNAs. Further embodiments of the invention include biologically, diagnostically, prophylactically, clinically or therapeutically useful variants thereof, and compositions comprising the same.
In accordance with another aspect of the invention, there is provided the use of a polynucleotide of the invention for therapeutic or prophylactic purposes, in particular genetic immunization. Among the particularly preferred embodiments of the invention are naturally occurring allelic variants of def1 and polypeptides encoded thereby.
Another aspect of the invention there are provided novel polypeptides of
Streptococcus pneumoniae
referred to herein as def1 as well as biologically, diagnostically, prophylactically, clinically or therapeutically useful variants thereof, and compositions comprising the same.
Among the particularly preferred embodiments of the invention are variants of def1 polypeptide encoded by naturally occurring alleles of the def1 gene.
In a preferred embodiment of the invention there are provided methods for producing the aforementioned def1 polypeptides.
In accordance with yet another aspect of the invention, there are provided inhibitors to such polypeptides, useful as antibacterial agents, including, for example, antibodies.
In accordance with certain preferred embodiments of the invention, there are provided products, compositions and methods for assessing def1 expression, treating disease, assaying genetic variation, and administering a deft polypeptide or polynucleotide to an organism to raise an immunological response against a bacteria, especially a
Streptococcus pneumoniae
bacteria.
In accordance with certain preferred embodiments of this and other aspects of the invention there are provided polynucleotides that hybridize to def1 polynucleotide sequences, particularly under stringent conditions.
In certain preferred embodiments of the invention there are provided antibodies against def1 polypeptides.
In other embodiments of the invention there are provided methods for identifying compounds which bind to or otherwise interact with and inhibit or activate an activity of a polypeptide or polynucleotide of the invention comprising: contacting a polypeptide or polynucleotide of the invention with a compound to be screened under conditions to permit binding to or other interaction between the compound and the polypeptide or polynucleotide to assess the binding to or other interaction with the compound, such binding or interaction being associated with a second component capable of providing a detectable signal in response to the binding or interaction of the polypeptide or polynucleotide with the compound; and determining whether the compound binds to or otherwise interacts with and activates or inhibits an activity of the polypeptide or polynucleotide by detecting the presence or absence of a signal generated from the binding or interaction of the compound with the polypeptide or polynucleotide.
In accordance with yet another aspect of the invention, there are provided def1 agonists and antagonists, preferably bacteriostatic or bacteriocidal agonists and antagonists.
In a further aspect of the invention there are provided compositions comprising a def1 polynucleotide or a def1 polypeptide for administration to a cell or to a multicellular organism.
Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following descriptions and from reading the other parts of the present disclosure.
DESCRIPTION OF THE INVENTION
The invention relates to novel def1 polypeptides and polynucleotides as described in greater detail below. In particular, the invention relates to polypeptides and polynucleotides of a novel def1 of
Streptococcus pneumoniae
, which is related by amino acid sequence homology to fms,pdf,def polypeptide. The invention relates especially to def1 having the nucleotide and amino acid sequences set out in Table 1 as SEQ ID NO: 1 and SEQ ID NO: 2 respectively def1.
TABLE 1
def1 Polynucleotide and Polypeptide Sequences
(A) Sequences from
Streptococcus pneumoniae
def1 polynucleotide sequence [SEQ ID NO:1].
5′-ATGTCTGCAATAGAACGTATTACAAAAGCTGCTCACTTAATTGATATGAACGATATTATC CGTGAAGGGAATCCTWCTCTACGCACGGTTGCTGAGGAAGTCACTTTCCCCCTATCTGAC CAGGAAATCATCCTAGGCGAAAAGATGATGCAATTCCTTAAACATTCCCAAGATCCTGTC ATGGCTGAAAAAATGGGACTCCGCGGTGGTGTTGGACTGGCTGCTCCCCAGTTAGATATC TCAAAACGCATTATCGCTGTTTTGGTACCTAATATTGTTGAAGAAGGCGAAACTCCACAG GAAGCCTACGATTTGGAAGCCATTATGTACAATCCAAAAATCGTCTCTCACTCTGTTCAA GATGC

Affiliated with

Also associated with

Rating

def1 does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with def1, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and def1 will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-2534204