Checkpoint-activating oligonucleotides

Details Checkpoint-activating oligonucleotides Checkpoint-activating oligonucleotides

2001-05-04

2003-07-15

Chan, Christina (Department: 1644)

Chemistry: molecular biology and microbiology

Micro-organism, tissue cell culture or enzyme using process...

Recombinant dna technique included in method of making a...

C435S252300, C435S320100, C536S023500, C530S352000

Reexamination Certificate

active

06593110

ABSTRACT:

FIELD OF THE INVENTION
The present invention relates generally to cell cycle progression and more specifically to molecules involved in regulating DNA replication checkpoints.
BACKGROUND OF THE INVENTION
DNA damage, if not properly repaired, results in genomic instability, which is highly mutagenic and potentially lethal to the cell. During the cell cycle, the integrity of chromosomal DNA is ensured by surveillance systems that sense damaged DNA and arrest the cell cycle, giving the cell more time for repair processes. The surveillance systems that inhibit the entry into mitosis in the presence of damaged (or unreplicated) DNA consist of checkpoint signaling pathways that ultimately regulate the Cdc2-cyclin B complex, also known as maturation or M-phase promoting factor (MPF). In various organisms, these pathways contain the phosphoinositide kinase (PIK) relatives ATM, ATR, Rad3, and Mec1, and the effector kinases Chk2, Cds1, Rad53, and Chk1. The phosphatase Cdc25 and kinases Wee1 and Myt1 directly control the inhibitory phosphorylation of Cdc2, which is maintained when upstream checkpoint regulators detect damaged or unreplicated DNA in the cell.
Although many types of DNA damage can activate a checkpoint, it is largely unknown what DNA structure is the ultimate damage signal. The radiomimetic agent methylmethane sulfonate (MMS), which elicits a strong Mec1-dependent checkpoint response in budding yeast, creates adducts and apurinic sites, which become single-and double-stranded breaks. Likewise, both UV and ionizing irradiation induce a DNA damage checkpoint in various organisms. UV causes the formation of pyrimidine dimers, which are repaired predominantly by nucleotide excision, whereas ionizing irradiation generates mainly double-stranded breaks. Since DNA damage can arise by multiple mechanisms and the processing of primary DNA lesions can be complex in eukaryotic cells, it has been difficult to characterize at a molecular level the DNA structures that elicit checkpoint responses.
In addition to DNA damage, DNA replication blocks can also trigger a cell cycle arrest. The signal(s) that elicits this arrest is unknown, but possibilities include replication intermediates, such as single-stranded DNA, which might accumulate when DNA synthesis is stalled. In budding yeast, the length of a cell cycle arrest in response to DNA damage correlates with the amount of the single-stranded DNA that is generated by endonucleolytic processing. Furthermore, the addition of single-stranded M13 DNA to Xenopus egg extracts results in a strong cell cycle delay.
Studies of the yeasts have revealed that DNA damage and replication blocks may be recognized by a group of proteins, each of which is required for a normal checkpoint. In the fission yeast
Schizosaccharomyces pombe
, for example, this group of gene products includes Rad1, Rad3, Rad9, Rad17, Rad26, Hus1, Cut5, and Crb2. Rad3 has substantial structural similarity to the human ATM and ATR proteins, each of which possesses protein kinase activity. A similar pathway exists in the budding yeast
Saccharomyces cerevisiae
. The biochemical functions of the other proteins in this group are poorly understood, but they are currently thought to be involved in sensing damaged DNA or stalled replication complexes. Cds1 and Chk1 are two effector kinases with overlapping functions that receive signals from upstream checkpoint sensors. DNA damage and replication blocks activate Cds1 by a mechanism that requires these proteins. Chk1, however, is normally activated in response to only DNA damage. Both Cds1 and Chk1 phosphorylate and inhibit the function of Cdc25, the protein phosphatase that dephosphorylates tyrosine-15 of the cyclin-dependent kinase Cdc2. Mammalian homologues of many of these checkpoint proteins have been isolated and have been shown to possess similar biochemical functions, indicating that many features of these checkpoint pathways have been conserved throughout evolution.
Xenopus egg extracts have been used to study vertebrate checkpoint mechanisms. Immunodepletion of a Xenopus homologue of Chk1 (Xchk1) results in a substantial but not complete abrogation of the cell cycle delay in Xenopus egg extracts in response to replication blocks induced by aphidicolin or to UV-damaged DNA. Xchk1 is involved in a caffeine-sensitive pathway, but that a caffeine-insensitive pathway is also involved in the response to aphidicolin and UV radiation. There is therefore a need to identify all key components of checkpoint pathways.
SUMMARY OF THE INVENTION
The present invention provides substantially pure polypeptides characterized as (a) phosphorylating Cdc25 or a homologue thereof; (b) having a molecular mass of about 58 kD; (c) having about 517 amino acids; (d) having SQ/TQ motifs at the amino terminal region; (e) having a carboxyl terminal kinase domain; and (f) having an amino terminal forkhead-associated domain.
Also provided by the invention is a substantially pure polypeptide having an amino acid sequence as set forth in SEQ ID NO:2 or conservative variants thereof.
Further provided by the invention is an isolated polynucleotide encoding a polypeptide polypeptides characterized as (a) phosphorylating Cdc25 or a homologue thereof; (b) having a molecular mass of about 58 kD; (c) having about 517 amino acids; (d) having SQ/TQ motifs at the amino terminal region; (e) having a carboxyl terminal kinase domain; and (f) having an amino terminal forkhead-associated domain. The invention also provides an isolated polynucleotide having the sequence set forth in SEQ ID NO: 1 and degenerate variants thereof
The invention also provides isolated polynucleotides isolated polynucleotide selected from the group consisting of (a) a polynucleotide encoding a polypeptide having an amino acid sequence as set forth in SEQ ID NO:2; (b) a polynucleotide of (a), wherein all T's are U; and (c) a polynucleotide complementary to (a) or (b). Also provided are isolated polynucleotide fragments having at least 15 base pairs and that hybridizes to a polynucleotide encoding a polypeptide having the amino acid sequence set forth in SEQ ID NO:2.
Also provided by the present invention are isolated oligonucleotides having
GACTCCGAGAACCAATTGC
(SEQ ID NO:3),.

GCAATTGGTTCTCGGAGTC
(SEQ ID NO:4), and

GCGGCACGTTCTCGTGCCGC
(SEQ ID NO:5).
The invention further provides an antibody that binds to a Cds1 polypeptide or immunoreactive fragments thereof Polyclonal and monoclonal antibodies are contemplated.
Also provided are methods for increasing mitotic delay in a vertebrate cell. The method includes providing to the cell one or more oligonucleotides that from double-stranded DNA.
Yet another embodiment of the invention provides a method for identifying a reagent that modulates phosphorylation of a polypeptide. The method includes incubating a reagent with the polypeptide, and one or more oligonucleotides that form double-stranded DNA, under conditions that allow the components to interact with each other; and comparing the phosphorylation of the polypeptide to phosphorylation of a polypeptide not incubated with the reagent, wherein a difference in phosphorylation is indicative of a reagent that modulates phosphorylation of the polypeptide. The modulation can be an increase in phosphorylation or a decrease in phosphorylation.
Yet a further embodiment of the invention provides a method for modulating cell cycle progression in a cell. The method includes providing to the cell a compound that affects the activity or expression of a Cds1 polypeptide, thereby modulating cell cycle progression.
Another embodiment of the invention provides a method of treating a subject having a cellular disorder associated with increased cell cycle progression compared to a subject not having the cellular disorder. The method includes administering to a subject having the disorder a therapeutically effective amount of a reagent that increases a Cds1 polypeptide activity, thereby treating the cellular disorder.
Yet another embodiment of the invention provides a method of diagnosing a Cds1-associated disor

Affiliated with

Also associated with

Rating

Checkpoint-activating oligonucleotides does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Checkpoint-activating oligonucleotides, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Checkpoint-activating oligonucleotides will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-3077346