Candida magnoliae producing mannitol and fermentation method...

Details Candida magnoliae producing mannitol and fermentation method... Candida magnoliae producing mannitol and fermentation method...

2001-10-18

2003-03-04

Lilling, Herbert J. (Department: 1651)

Chemistry: molecular biology and microbiology

Micro-organism, tissue cell culture or enzyme using process...

Preparing oxygen-containing organic compound

C435S254220, C435S921000

Reexamination Certificate

active

06528290

ABSTRACT:

BACKGROUND OF THE INVENTION
The present invention relates to a fermentation process for producing mannitol from fructose using a novel strain,
Candida magnoliae
(KCCM-10252) producing mannitol in high yield and high productivity, and a novel strain of
Candida magnoliae
(KCCM-10252) which is isolated from a natural substance.
Mannitol is a six carbon sugar alcohol, and it is contained in natural substances, such as, brown algae, mushrooms, fungi and the like in nature. Since it has 30~40% of sugar's sweetness, not only it can be used as an alternative sweetening agent in the food processing industry where the use of sugar is limited, but also it can be mostly used as an additive for confectionary, a filler for medicine, a surfactant, a waterproof agent and the like, because it has superior properties, such as, a cool taste, low hygroscopic property, fluidity and the like. Further, it has been widely used in the food and pharmaceutical industry, for example, as a therapeutic intermediate of hypotension and a coating agent for reducing a bitter taste during the manufacturing various drugs.
Mannitol exists in many kinds of fruits or vegetables as a natural product in a very small amount. Therefore, it is industrially of little economical value to extract mannitol from fruits or vegetables.
One of the commercialized methods for producing mannitol comprises i) isolating the fructose formed by hydrolysis from sugar and the like ; and ii) manufacturing the mannitol by hydrogenation to the fructose in the presence of a catalyst under high temperature and high pressure. However, since the sorbitol is produced as a by-product in such manufacturing process, it is required to purify the mannitol in order to eliminate the sorbitol as a separate step. Of course, the conversion yield is so much low that its production cost becomes high. Further, such manufacturing process has handicaps, such as, a risk of dangerousness and requirement of wastes treatment, because it includes the reaction under high temperature and high pressure.
In order to solve such drawbacks, many studies on a method for producing mannitol by using microorganisms have been conducted. As the known microorganisms related with production of mannitol, in case of any yeast, there are
Candida zeylannoide, Candida lipolitica, Cryptococcus neoformans, Torulopsis mannitofaciens
, etc.,; in case of bacteria, there are
Lactobacillus brevis, Leuconostoc mesenteriode, Mycobacterium smegmatis
, etc.,; and in case of fungi, there are
Mucor rouxii, Aspergillus nidulans, Penicillum scabrosum
, etc. The method for producing mannitol by using microorganisms has a high economical value. Further, since only mannitol can be specifically produced from glucose or fructose according to the method, the process for isolating and purifying mannitol after completion of the fermentation for mannitol can be performed with much convenience. However, it is difficult to industrialize this method, because its productivity and yield is not so high.
SUMMARY OF THE INVENTION
It is, therefore, an objective of the present invention to provide a method for producing mannitol in high productivity and high yield by isolating, identifying and developing a new strain,
Candida magnoliae
producing mannitol in high yield from a fermentation sludge collected from xylitol manufacturing company (Bolak Co., Ltd., Osan, Korea) and further optimizing culture conditions.
The object of the present invention is to provide novel strain of
Candida magnoliae
, which was deposited Korea Culture Center of Microorganism, 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, Seoul, 120-091, Republic of Korea with accession number KCCM-10252 on Mar. 5, 2001 under Budapest treaty, for preparing mannitol with high yield and high productivity.
Another object of the present invention is to provide the fermentation process for manufacturing mannitol with high yield and high productivity, using strain of
Candida magnoliae
(KCCM-10252) comprising the steps of: i) fermenting glucose or fructose medium with microorganism by controlling following fermentation conditions; a) composition of medium for maximum production of mannitol consists of 50~100 g/L of glucose, 50~120 g/L of fructose, 5~20 g/L of yeast extract, 1~5 g/L of ammonium sulfate, 1.0~5.0 g/L of dibasic potassium phosphate and 0.1~0.5 g/L of magnesium sulfate; b) pH of culture medium is 4.5~5.5; c) temperature of cultivation is 27~35° C.; d) aeration rate is 0~0.5 volume of air per volume of medium per minute; and e) agitation speed of the medium is 200~500 rpm; ii ) removing the cells and other residue from the fermentation medium; and iii) separating and recovering mannitol from the fermentation medium of step ii).
The further object of the present invention is to provide a fermentation process wherein the strain used for fermentation is prepared by cultivating frozen
Candida magnoliae
(KCCM-10252) in YPD medium comprising 15~25 g/L of glucose, 7~13 g/L of yeast extract and 15~25 g/L of peptone.
Also, the present Invention is to provide an isolating method for novel strain,
Candida magnoliae
(KCCM-10252), comprising steps of i) sorting a single colony growing fast at 27~33° C. by using a plate containing 10~20 g/L of glucose, 18~22 g/L of fructose, 15~25 g/L of peptone, 7~15 g/L of yeast extract and 12~17 g/L of agar after diluting a natural sludge sample; ii) sorting the strain producing mannitol most after fermenting such sorted strains in the medium containing 30~70 g/L of glucose, 50~100 g/L of fructose, 5~20 g/L of yeast extract, 1~5 g/L of ammonium sulfate and 1~5 g/L of dibasic potassium phosphate for 68~76 hours, and iii) isolating the novel strain,
Candida magnoliae
(KCCM-10252) producing the mannitol.
DETAILED DESCRIPTION OF THE INVENTION
The method for isolating the new strain,
Candida magnoliae
according to the present Invention is described as follows.
After properly diluting a fermentation sludge sample collected from xylitol manufacturing company, a single colony with priority given to strains growing fast at 27~33° C. was sorted by using the plate containing 200~400 g/L of glucose, 15~25 g/L of peptones, 7~15 g/L of yeast extract and 12~17 g/L of agar, and further the strain producing mannitol most was finally sorted after such sorted strains were fermented in the medium containing 30~70 g/L of glucose, 50~100 g/L of fructose, 5~20 g/L of yeast extract, 1~5 g/L of ammonium sulfate and 1~5 g/L of dibasic potassium phosphate for 68~76 hours.
For identification of the strain, the method (Kurtzman & Robnett, 1998) for analyzing the nucleotide sequence of 26s rRNA and the morphological, cultural, and physiological properties thereof were examined in accordance with Yarrow's method (Elsevier Science Publishers, Amsterdam, 1998) and further the strain was identified according to the classification method of Barnett, et al.(Yeasts: Characteristics and identification. Cambridge University Press, London, 1983). The results of analyzing the nucleotide sequence of 26s rRNA of the sorted strain and the nucleotide sequence of similar seeds are shown in Table 1 and Table 2, respectively.
TABLE 1
Nucleotide Sequence of 26s rRNA of the New Strain,
Candida magnoliae
producing Mannitol
5′-AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCC
TAGTAATGGCGAATGAACAGGCAAAAGCTCAGATTTGAAACCCTCGGGAT
TGTAATCTGGAGACCTGGATTTGGCACGCTGACCAAGTCTTCTGGAACGG
AGCGCCATGGAGGGTGACAGCCCCGTAGCAGCAGCCGCAGTAAATCCGGG
TCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATGCTC
CATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGA
AGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATT
GTTGAAATGGAAGGCAATGAGGTGCGATTGACCCGGACGTTTGCGGGCAG
CACAAAAGCGCAGGCCGCCTCGGCATTGCCTGCGTGCATACTGCCTCGCG
GACCACCGGTTCTAACAACGCCTTATTGCAC-3′
TABLE 2
Similarity of Nucleotide sequence of 26s rRNA D1/D2 domain
between the Novel Strain,
Candida magnoliae
producing
Mannitol and Similar seeds
Similarity
Strain
Accession No.
(%)
Candida magnoliae
NRRL Y-2024
U45722
100
Candida geochares
NRRL Y-17073T
U48591
97.56
Candida vaccinii
NRRL Y-17684T
U45708
95.77
Candida apis

Affiliated with

Also associated with

Rating

Candida magnoliae producing mannitol and fermentation method... does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Candida magnoliae producing mannitol and fermentation method..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Candida magnoliae producing mannitol and fermentation method... will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-3071131