Drug – bio-affecting and body treating compositions – Extract – body fluid – or cellular material of undetermined... – Derived from arthropod
Reexamination Certificate
1999-09-13
2002-05-28
Stucker, Jeffrey (Department: 1647)
Drug, bio-affecting and body treating compositions
Extract, body fluid, or cellular material of undetermined...
Derived from arthropod
C424S537000, C435S069100, C435S069500, C435S320100, C435S325000, C536S023100
Reexamination Certificate
active
06395306
ABSTRACT:
FIELD OF THE INVENTION
This invention relates to the field of cloning and expression of a protein with therapeutic value in the treatment of various diseases, especially inflammatory diseases such as rheumatoid arthritis. More specifically, the invention relates to a novel protein called PX3.101 purified from honey bee venom and the gene encoding the protein.
BACKGROUND OF THE INVENTION
The immune system plays a critical beneficial role in combating infections. However, in some instances improper immune responses can result in many disabling diseases. Autoimmune or immune-system mediated diseases may be either B-cell mediated (i.e., antibody-mediated) or T-cell mediated. Many autoimmune diseases involve an undesirable inflammatory response. Examples of such diseases include rheumatoid arthritis, chronic hepatitis, Crohn's disease, psoriasis, vasculitis, and the like.
Existing therapies for autoimmune diseases, particularly those involving an undesirable inflammatory response are inadequate. Most immune system-mediated diseases are chronic conditions that require the prolonged administration of drugs to address the symptoms of the disease. Accordingly, an important criterion for drugs used to treat these diseases is low toxicity. However, many drugs utilized to treat autoimmune diseases (e.g., steroids and non-steroidal anti-inflammatory compounds (NSAIDs)), have significant toxic side effects that become manifest after prolonged periods of use. Various immunosuppressive drugs (e.g., cyclosporin A and azathioprine) have also been used to treat autoimmune diseases. However, these compounds are relatively non-specific and have the adverse effect of weakening the entire immune system, thus leaving the patient susceptible to infectious disease.
A variety of inflammatory diseases, including rheumatoid arthritis, are associated with interleukin 8 (IL-8). IL-8 is a chemokine that promotes the recruitment and activation of neutrophil leukocytes and represents one of several endogenous mediators of acute inflammatory response. IL-8 has also been variously referred to as neutrophil-activating factor, monocyte-derived neutrophil chemotactic factor, interleukin-8 (IL-8) and neutrophil-activating peptide. The term IL-8 has gained the most widespread acceptance and is used herein.
Inflammation and autoimmune responses commence with the migration of leukocytes out of the microvascular into the extravascular space in response to chemoattractant molecules. Chemoattractants may originate from the host and include chemokines and activated complement components, or may be released from an invading organism. Once exposed to chemoattractants within the vasculature, the leukocytes become activated and capable of adhering to the endothelium providing the first step in the development of inflammation. Stimulated neutrophils adhere to the endothelium of the microvasculature in response to a gradient of chemoattractants which direct the cells into the extravascular space toward the source of the chemoattractant. See, for example, Anderson et al.,
Journal Clin. Invest.
74:536-551, (1984); Ley, K. et al.,
Blood
77:2553-2555, (1991); Paulson, J. C., “Selectincarbohydrate-mediated adhesion of leukocytes”,
Adhesion: Its Role in Inflammatory Disease,
W. H. Freeman, 1992; Lasky, L. A., “The homing receptor” (LECAM 1/L-selectin),
Adhesion: Its role in inflammatory disease,
W. H. Freeman, (1992).
Rheumatoid arthritis is one of the more prevalent autoimmune and inflammatory diseases. The disease afflicts approximately 1% of the total population and about 2.5 million persons in the United States alone. Direct prescription usage is estimated at $5.6 billion worldwide. For individuals suffering from rheumatoid arthritis, the individual's immune system mistakenly perceives the body's own joint tissue as foreign and thus initiates an abnormal immune response. The disease is characterized by chronic inflammation, destruction of cartilage, and ultimately bone erosion and the destruction of joints.
As with other inflammatory diseases, known treatments for IL-8 mediated diseases and rheumatoid arthritis can include the use of nonspecific immunosuppressive drugs that suppress the entire immune system; as noted above, however, such treatments put the patient at risk for contacting an infectious disease. Prolonged use of such drugs can also result in severe side effects. Moreover, immunosuppressive drugs are only partially effective in mitigating the symptoms of rheumatoid arthritis and the utility of the treatment tends to decrease with time.
Other therapies currently used are non-steroid anti-inflammatory drugs (NSAIDs), corticosteroids and a variety of disease modifying anti-rheumatic drugs (DMARDs). There is general dissatisfaction with these drugs for two major reasons: (i) incidence of adverse side effects, which lead to over 700, 000 hospitalizations every year, and (ii) inability to reverse disease progression.
Given the paucity of effective treatments for inflammatory diseases and autoimmune diseases generally, and the need for effective compositions for treating diseases associated with IL-8 such as rheumatoid arthritis more particularly, there is a significant need for new substances that can be used in the treatment of these diseases.
The present invention provides novel isolated proteins and nucleic acids encoding the proteins that are effective in treating autoimmune and inflammatory diseases, especially rheumatoid arthritis. The peptides of the invention also can inhibit the binding of IL-8 to its receptor and inhibit a variety of enzymes associated with inflammatory diseases.
SUMMARY OF THE INVENTION
The invention provides nucleic acid molecules that include a polynucleotide sequence that encodes a PX3.101 polypeptide or fragments thereof. The polypeptides of the invention have an amino acid sequence at least 75% identical to an amino acid sequence as set forth in SEQ ID NO:2 over a region at least about 40 amino acids in length when compared using the BLASTP algorithm with a wordlength (W) of 3, and the BLOSUM62 scoring matrix. The polynucleotide sequences are preferably at least 75% identical to a nucleic acid sequence set forth in residues 74 to 349 of SEQ ID NO:1 over a region of at least 50 nucleotides in length when compared using the BLASTN algorithm with a wordlength (W) of 11, M=5, and N=−4.
Nucleic acids of the invention also include isolated nucleic acid molecules comprising a nucleotide sequence selected from the group consisting of: (a) deoxyribonucleotide sequence complementary to nucleotides 74 to 349 of SEQ ID NO:1; (b) a ribonucleotide sequence complementary to nucleotides 74 to 349 of SEQ ID NO:1; (c) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b); (d) a nucleotide sequence of at least 23 consecutive nucleotides capable of hybridizing to nucleotides 74 to 349 of SEQ ID NO:1; and (e) a nucleotide sequence capable of hybridizing to a nucleotide sequence of (d). The nucleic acid molecules of the invention will generally hybridize to a polynucleotide sequence consisting of nucleotides 74 to 349 of SEQ ID NO:1 under stringent conditions. An exemplary nucleic acid of the invention is a nucleic acid consisting of nucleotides 74 to 349 of SEQ ID NO:1. Nucleic acids of the invention also include those which are capable of being amplified with forward primer 5′ AAGGATCCACAGTGCAACGTAAGTTC 3′ (SEQ ID NO:3) and reverse primer 5′ ACTGATAAAATAATAAC 3′ (SEQ ID NO:5).
The invention also provides polypeptides that have an amino acid sequence at least 75% identical to an amino acid sequence as set forth in SEQ ID NO:2 over a region at least 40 amino acids in length when compared using the BLASTP algorithm with a wordlength (W) of 3, and the BLOSUM62 scoring matrix. Polypeptides of the invention include polypeptides encoded by a nucleic acid segment that hybridizes under stringent conditions to a nucleic acid fragment having the sequence set forth in SEQ ID NO:1. Polypeptid
Cui Xiangmin
Lu Yuefeng
Ausenhus Scott
Pan Pacific Pharmaceuticals, Inc.
Seharaseyon Jegatheesan
Stucker Jeffrey
Townsend and Townsend / and Crew LLP
LandOfFree
Bee venom protein and gene encoding same does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Bee venom protein and gene encoding same, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Bee venom protein and gene encoding same will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-2832419