Baculovirus containing minimal CMV promoter

Details Baculovirus containing minimal CMV promoter Baculovirus containing minimal CMV promoter

1999-07-29

2002-04-09

Guzo, David (Department: 1636)

Chemistry: molecular biology and microbiology

Micro-organism, tissue cell culture or enzyme using process...

Recombinant dna technique included in method of making a...

C435S320100, C435S455000, C435S456000, C435S348000, C435S235100

Reexamination Certificate

active

06368825

ABSTRACT:

BACKGROUND OF THE INVENTION
The baculoviruses are a family of DNA viruses which primarily infect insects of the order Lepidoptera. Baculovirus genomes are double-stranded DNA molecules, generally about 80-230 kb in length.
Baculoviruses are able to express large quantities of non-baculovirus proteins driven by the endogenous polyhedrin and p10 promoters, both of which are strongly active during the late stage of the virus life cycle. However, for some proteins, expression earlier in the baculovirus life cycle may be appropriate and preferred. For example, it may be desirable to drive expression of a glycoprotein earlier in the virus life cycle since, by the late stage of the virus life cycle, post-translational glycosylation is at least somewhat impaired.
SUMMARY OF THE INVENTION
The invention is based on the discovery that a minimal cytomegalovirus (CMV) immediate-early promoter can efficiently drive expression of a gene in a baculovirus vector. Because the CMV promoter is not regulated through the virus life cycle, this discovery allows the construction of a recombinant baculovirus containing minimal CMV promoter which is capable of high-level expression of a RNA or protein in the early stage, as well as the late stage, of the virus life cycle.
Accordingly, the invention features a baculovirus having a genome which includes a CMV promoter sequence and a sequence encoding an RNA (e.g., a non-baculovirus RNA). The expression of the RNA (e.g., a mRNA encoding a non-baculovirus protein) is driven by a minimal CMV promoter sequence (e.g., SEQ ID NO:1). Examples of minimal CMV promoter sequences include those that are free of SEQ ID NO:2, an upstream sequence often included in full-length CMV promoter sequences but absent in minimal CMV promoter sequences. These sequences are shown below.
A CMV minimal promoter sequence:
taggcgtgtacggtgggaggictatataagcagagctcgtttagtgaaccgtcagatcac tagaagctttattgcggtagtttatcacagttaaattgctaacgcagtcag (SEQ ID NO:1)
A sequence deleted from a full length CMV promoter:
tcaatattggccattagccatattattcattggttatatagcataaatcaatattggcta ttggccattgcatacgttgtatctatatcataatatgtacatttatattggctcatgtcc aatatgaccgccatgttggcattgattattgactagttattaatagtaatcaattacggg gtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggccc gcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccat agtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgc ccacttggcagtacatcaagtgtatcatatgccaagtccgccccctattgacgtcaatga cggtaaatggcccgcctggcattatgcccagtacatgaccttacgggactttcctacttg gcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacac caatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgt caatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaataaccc cgccccgttgacgcaaatgggcgg (SEQ ID NO:2)
In the naturally occurring CMV genome, the CMV minimal promoter sequence (SEQ ID NO:1) is immediately downstream of the sequence deleted from the full length CMV promoter sequence (SEQ ID NO:2).
When a CMV promoter sequence is said to be free of SEQ ID NO:2, it means that the promoter sequence does not contain the complete nucleotide sequence of SEQ ID NO:2. Thus, the promoter sequence can contain a fragment of SEQ ID NO:2 and still be considered free of SEQ ID NO:2. Typically, a suitable CMV promoter sequence in the baculoviruses of the invention has a substantial deletion within SEQ ID NO:2 (e.g., at least 25, 50, 100, or 200 nucleotides deleted). Suitable CMV promoters can even contain a single nucleotide deletion of SEQ ID NO:2 and still be considered free of SEQ ID NO:2.
A CMV promoter sequence is any sequence derived from, but not necessarily identical to, a naturally occurring cytomegalovirus which is capable of driving RNA transcription in the context of a baculovirus genome. A non-baculovirus RNA or protein is any RNA or protein which is not encoded by the genome of a naturally occurring baculovirus, although a portion of a non-baculovirus RNA or protein can include a baculovirus sequence. For example, the non-baculovirus protein can be a fusion protein formed from a baculovirus protein and a human protein. The non-baculovirus protein can also be a detectable protein, such as luciferase, or an insect toxin that can augment the use of a baculovirus as a live biopesticide. Detectable proteins can exhibit enzymatic, radioactive, chromogenic, fluorescent, or luminescent properties.
The invention also includes a method of expressing a non-baculovirus RNA or protein in an insect cell by infecting the insect cell with a baculovirus of the invention.
The baculoviruses and methods of the invention provide life-cycle independent, high level expression of foreign RNAs and proteins (including recombinant baculovirus RNAs or proteins which are driven by a minimal CMV promoter). For example, an RNA encoding a biopesticide protein can be encoded by a sequence in a recombinant baculovirus. This baculovirus can then be used to control insect pest populations by natural infection.


REFERENCES:
patent: 5731182 (1998-03-01), Boyce
patent: 6004941 (1999-12-01), Bujard et al.
Harding, T. C. et al., “Tetracycline-Regulated Transgene Expression in Hippocampal Neurones Following Transfection with Adenoviral Vectors,” Journal of Neurochemistry, vol. 69, No. 6, pp. 2620-2623, 1997.
Gossen, Manfred et al., “Tight control of gene expression in mammalian cells by tetracycline-responsive promoters,” Proc. Natl. Acad. Sci., vol. 89, pp. 5547-5551, 1992.
Ho, Dora Y. et al., “Inducible gene expression from defective herpes simplex virus vectors using the tetracycline-responsive promoter system,” Molecular Brain Research, vol. 41, pp. 200-209, 1996.
Paulus, Werner et al., “Self-Contained, Tetracycline-Regulated Retroviral Vector System for Gene Delivery to Mammalian Cells,” vol. 70, No. 1, pp. 62-67, 1996.
Pfeifer, Tom A. et al., “Baculovirus immediate-early promoter-mediated expression of the Zeocin™ resistance gene for as a dominant selectable marker . . . ,” vol. 188, pp. 183-190, 1997.

Affiliated with

Also associated with

Rating

Baculovirus containing minimal CMV promoter does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Baculovirus containing minimal CMV promoter, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Baculovirus containing minimal CMV promoter will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-2829453