Organic compounds -- part of the class 532-570 series – Organic compounds – Carbohydrates or derivatives
Reexamination Certificate
2007-05-29
2007-05-29
Zara, Jane (Department: 1635)
Organic compounds -- part of the class 532-570 series
Organic compounds
Carbohydrates or derivatives
C435S006120, C435S091100, C435S366000, C435S368000, C435S455000, C435S458000, C530S326000, C536S023100
Reexamination Certificate
active
10185084
ABSTRACT:
The present invention provides for an antisense oligonucleotide having the sequence 5′GCTCGGCGCCGCCATTTCCAG3′. The invention also provides for an antisense oligonucleotide having the sequence 5′GTCAGCGGCCATCAGCTT3′. The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5′GCTCGGCGCCGCCATTTCCAG3′ and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5′GCTCGGCGCCGCCATTTCCAG3′ effective to inhibit death of the cell.
REFERENCES:
patent: 5929042 (1999-07-01), Troy et al.
patent: WO9500160 (1995-01-01), None
patent: WO9600297 (1996-01-01), None
patent: WO9838861 (1998-09-01), None
Kumar, s. et al., Genes & Development, vol. 8, No. 14, pp. 1613-1626 (1994).
Kumar, S. et al., Biochem. Biophys. Res. Commun., vol. 185, No. 3, pp. 1155-1161 (1992).
Batistatou, A., Greene L.A. (1991) Aurintricarboxylic acid rescues PC12 cells and sympathetic neurons from cell death caused by nerve growth factor deprivation: correlation with suppression of endonuclease activity. J. Cell Biol. 115:461-471.
Branch, A. (1998) A good antisense molecule is hard to find. Trends Biochem. Sci. 23:45-50.
Coyle, J.T. and Puttfarcken P. (1993) Oxidative stress, glutamate, and neurodegenerative disorders. Science 262:689-95.
Crooke, S.T., ed. (1998) Basic principles of antisense therapeutics. Antisense Research and Application, Ch. 1 p. 1-50, published by Springer-Verlag.
Crystal, R.G. (1995) Transfer of genes to humans: early lessons and obstacles to success. Science 210:404-10.
Dorn et al. (1994) Homeodomain proteins in development and therapy. Pharm. Ther. 61:155-83.
Farinelli, S.E. et al. (1996) Nitric oxide delays the death of trophic factor-deprived PC12 cells and sympathetic neurons by a cGMP-mediated mechanism. J .Neurosci. 16:2325-2334.
Fernandes-Alnemri, T. et al. (1994) CPP32, a novel human apoptotic protein with homology toCaenorhabditis eleganscell death protein ced-3 and the mammalian IL-1β-converting enzyme. J. Biol. Chem. 269:30761-64.
Ferrari, G. et al. (1995) N-acetylcysteine (D- and L-stereoisomers) prevents apoptotic death of neuronal cells. J. Neurosci. 15:2857-2866.
Friedmann, T. (1997) Overcoming the obstacles. Sci. Am. Jun. p. 96-101.
Gagliardini, V. et al. (1994)( Prevention of vertebrate neuronal death by the crmA gene. Science 263:826-28.
Greene, L.A. (1978) Nerve growth factor prevents the death and stimulates the neuronal differentiation of clonal PC12 pheochromocytoma cells in serum-free medium. J. Cell Biol. 78:747-755.
Hengartner, M.O. et al. (1992)Caenorhabditis elegansgene ced-9 protects cells from programmed cell death. Nature 356:494-99.
Kumar, S. (1995) Inhibition of apoptosis by the expression of antisense Nedd2. FEBS Lett. 368:69-72.
Kumar, S. et al. (1994) Induction of apoptosis by the mouse Nedd2 gene, which encodes a protein similar to the product of theCaenorhabditis eleganscell death gene ced-3 and the mammalian IL-1β-converting enzyme. Genes Dev. 8:1613-26.
Lindenboim, L. et al. (1995) Inhibition of drug-induced apoptosis by survival factors in PC12 cells. J Neurochem. 64:1054-63.
Mesner, P.W. et al. (1992) Nerve growth factor withdrawal-induced cell death in neuronal PC12 cells resembles that in sympathetic neurons. J. Cell Biol. 119:1669-80.
Miura, M. et al. (1994) Induction of apoptosis in fibroblasts by IL-1β-converting enzyme, a mammalian homolog of theC. elegascell death gene ced-3. Cell 75:653-60.
Prochiantz, A. (1996) Getting hydrophilic compounds into cells: lessons from homeopeptides. Curr. Opin. Neuro. 6:629-34.
Schofield, J.P. et al. (1995) Non-viral approaches to gene therapy. Brit. Med. Bull. 51:56-71.
Srinivasan, A. et al. (1996) Bcl-2 expression in neural cells blocks activation of ICE/CED-3 family proteases during apoptosis. J. Neurosci.16: 5654-60.
Troy, C.M. et al. (1990). Ontogeny of the neuronal intermediate filament protein, peripherin, in the mouse embryo. Neurosci. 36: 217-37.
Troy, C.M. et al. (1996) Down-regulation of SOD1 leads to cell death by the NO-peroxynitrite pathway. J. Neurosci. 16:253-61.
Troy, C.M. et al. (1992). Neurite outgrowth in peripherin-depleted PC12 cells. J. Cell Biol. 117:1085-92.
Troy, C.M. and Shelanski, M.L. (1994) Down-regulation of copper/zinc superoxide dismutase (SOD1) causes neuronal cell death. Proc. Natl. Acad. Sci. U.S.A. 91:6384-87.
Troy, C.M. et al. (1996) Mechanisms of neuronal degeneration: a final common pathway? Neuronal Regeneration, Reorganization and Repair, F. Seil, ed. (New York, NY: Raven Press), p. 103-12.
Troy, C.M. et al. (1996) The contrasting roles of ICE-family proteases and interleukin in apoptosis induced by trophic factor withdrawal and by SOD1 downregulation. Proc. Natl. Acad. Sci. U.S.A. 93: 5635-40.
Verma, I.M. et al. (1997) Gene therapy—promises, problems and prospects. Nature 389:239-42.
Wang, L. et al. (1994) Ich-1, an Ice/ced-3-related gene, encodes both positive and negative regulators of programmed cell death. Cell 78:739-50.
Yamin, T.T. et al. (1996) Activation of the native 45-kDa precursor form of IL-1β-converting enzyme. J. Biol. Chem. 271: 13273-82; and.
Yuan, J. et al. (1993) TheC. eleganscell death gene ced-3 encodes a protein similar to mammalian interleukin-1β-converting enzyme. Cell 74:641-52.
Shelanski Michael L.
Troy Carol M.
Cooper & Dunham
The Trustees of Columbia University in the City of New York
White John P.
Zara Jane
LandOfFree
Antisense compounds which prevent cell death and uses thereof does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Antisense compounds which prevent cell death and uses thereof, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Antisense compounds which prevent cell death and uses thereof will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-3780769