Antisense compounds which prevent cell death and uses thereof

Details Antisense compounds which prevent cell death and uses thereof Antisense compounds which prevent cell death and uses thereof

1997-03-03

1999-07-27

Ketter, James

Drug, bio-affecting and body treating compositions

Designated organic active ingredient containing

Carbohydrate doai

435352, 435366, 536245, A01N 4304

Patent

active

059290420

ABSTRACT:
The present invention provides for an antisense oligonucleotide having the sequence 5'GCTCGGCGCCGCCATTTCCAG3'(SEQ ID NO:1). The invention also provides for an antisense oligonucleotide having the sequence 5'GTCAGCGGCCATCAGCTT3'(SEQ ID NO:2). The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) effective to inhibit death of the cell.

REFERENCES:
Dorn et al. Pharmacology and Therapeutics, vol. 61, No. 1/2, pp. 155-184 1994.
Prochiantz, A. Current Opinion in Neurobiology. vol. 6, No. 5, pp. 629-634 1996.
Farinelli SE, Park DS, Greene LA (1996) Nitric oxide delays the death of trophic factor-deprived PC12 cells and sympathetic neurons by a cGMP-mediated mechanism. J. Neurosci. 16:2325-2334 (Exhibit 2).
Fernandes-Alnemri T, Litwack G, Alnemri ES (1994) CPP32, a novel human apoptotic protein with homology to Caenorhabditis elegans cell death protein ced-3 and the mammalian IL-1.beta.-converting enzyme J. Biol. Chem. 269:30761-30764 (Exhibit 3).
Farrari G, Yan CYI, Greene LA (1995) N-acetylcysteine (D- and L-stereoisomers) prevents apoptotic death of neuronal cells. J. Neurosci 15:2857-2866 (Exhibit 4).
Gagliardini V, Fernandez P-A, Lee RKK, Drexler HCA, Rotello RJ, Fishman MC, Yuan J. (1994) Prevention of vertebrate neuronal death by the crmA gene. Science 263:826-828 (Exhibit 5).
Greene LA (1978) Nerve growth factor prevents the death and stimulates the neuronal differentiation of clonal PC12 pheochromocytoma cells in serum-free medium. J Cell Biol 78:747-755 (Exhibit 6).
Hengartner MO, Ellis RE, Horvitz HR (1992) Caenorhabditis elegans gene ced-9 protects cells from programmed cell death. Nature. 356: 494-9 (Exhibit 7).
Kumar S (1995) Inhibition of apoptosis by the expression of antisense Nedd2. FEBS Letters 368:69-72 (Exhibit 8).
Kumar S, Knioshita M, Noda M, Copeland NG, Jenkins NA (1994) Induction of apoptosis by the mouse Nedd2 gene, which encodes a protein similar to the product of the Caenorhabditis elegans cell death gene ced-3 and the mammalian IL-1.beta.-converting enzyme. Genes & Develop 8:1613-1626 (Exhibit 9).
Lindenboim L, Haviv R, Stein R (1995) Inhibition of drug-induced apoptosis by survival factors in PC12 cells. J. Neurochem 64:1054-1063 (Exhibit 10).
Miura M, Zhu H, Rotello R, Hartweig EA, Yuan J (1994) Induction of apoptosis in fibroblasts by IL-1.beta.-converting enzyme, a mammalian homolog of the c. elegans cell death gene ced-3. Cell 75:653-660 (Exhibit 11).
Srinivasan A, Foster LM, Testa M-P, Ord T, Keane RW, Bredesan DE, Kayalar, C (1996) Bcl-2 expression in neural cells blocks activation of ICE/CED-3 family proteases during apoptosis. J Neurosci 16: 5654-5660 (Exhibit 12).
Troy CM, Brown K, Greene LA, and Shelanski ML (1990). Ontogeny of the neuronal intermediate filament protein, peripherin, in the mouse embryo. Neurosci. 36: 217-237 (Exhibit 13).
Troy CM, Derossi D, Prochiantz A, Greene LA, Shelanski ML (1996a) Down-regulation of SOD1 leads to cell death by the NO-peroxynitrate pathway. J. Neurosci 16:253-261 (Exhibit 14).
Troy CM, Greene LA, Shelanski ML (1992). Neurite outgrowth in peripherin-depleted PC12 cells. J Cell Biol 117:1085-1092 (Exhibit 15).
Troy CM, Shelanski ML (1994) Down-regulation of copper/zinc superoxide dismutase (SOD1) causes apoptotic death in PC12 neuronal cells. Proc. Natl. Acad. Sci. USA 91:6384-6387 (Exhibit 16).
Troy CM, Stefanis L, Prochiantz A, Greene LA, Shelanski ML (1996b) The contrasting roles of ICE-family proteases and interleukin-1.beta. in apoptosis induced by trophic factor withdrawal and by SOD1 downregulation. Proc Natl Acad Sci USA 93: 5635-5640 (Exhibit 17).
Troy CM, Stefanis L, Greene L A, Shelanski ML (1996c) Mechanisms of neuronal degeneration: a final common pathway? in Neuronal Regeneration, Reorganization and Repair F. Seil, ed. (New York, NY: Raven Press), pp. 103-112 (Exhibit 18).
Wang L, Miura M, Bergeron L, Zhu H, Yuan J (1994) Ich-1, an Ice/ced-3-related gene, encodes both positive and negative regulators of programmed cell death. Cell 78: 739-750 (Exhibit 19).
Yamin, Ting-Ting et al. (1996) "Activation of the Native 45-kDa Precursor Form of Interleukin-1-converting Enzyme," J. Biol. Chem. 271(22): 13273-13282 (Exhibit 20).
Yuan J, Shahan S, Ledoux S, Ellis HM, Horvitz HR (1993) The c. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin-1.beta.-converting enzyme. Cell 74: 641-652 (Exhibit 21).

Affiliated with

Also associated with

Rating

Antisense compounds which prevent cell death and uses thereof does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Antisense compounds which prevent cell death and uses thereof, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Antisense compounds which prevent cell death and uses thereof will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFUS-PAI-O-878789