Organic compounds -- part of the class 532-570 series – Organic compounds – Carbohydrates or derivatives
Reexamination Certificate
2001-04-11
2004-04-27
Mertz, Prema (Department: 1646)
Organic compounds -- part of the class 532-570 series
Organic compounds
Carbohydrates or derivatives
C435S069100, C435S325000, C435S071100, C435S071200, C435S252300, C435S254110, C435S471000, C530S350000
Reexamination Certificate
active
06727353
ABSTRACT:
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
Not applicable.
BACKGROUND OF THE INVENTION
Potassium channels are involved in a number of physiological processes, including regulation of heartbeat, dilation of arteries, release of insulin, excitability of nerve cells, and regulation of renal electrolyte transport. Potassium channels are thus found in a wide variety of animal cells such as nervous, muscular, glandular, immune, reproductive, and epithelial tissue. These channels allow the flow of potassium in and/or out of the cell under certain conditions. For example, the outward flow of potassium ions upon opening of these channels makes the interior of the cell more negative, counteracting depolarizing voltages applied to the cell. These channels are regulated, e.g., by calcium sensitivity, voltage-gating, second messengers, extracellular ligands, and ATP-sensitivity.
Potassium channels are made by alpha subunits that fall into 8 families, based on predicted structural and functional similarities (Wei et al.,
Neuropharmacology
35(7):805-829 (1997)). Three of these families (Kv, Eag-related, and KQT, now referred to as KCNQ) share a common motif of six transmembrane domains and are primarily gated by voltage. Two other families, CNG and SK/IK, also contain this motif but are gated by cyclic nucleotides and calcium, respectively. The three other families of potassium channel alpha subunits have distinct patterns of transmembrane domains. Slo family potassium channels (also known as BK channels) have seven transmembrane domains (Meera et al.,
Proc. Natl. Acad. Sci. U.S.A
. 94(25):14066-71 (1997)) and are gated by both voltage and calcium or pH (Schreiber et al.,
J. Biol. Chem
. 273:3509-16 (1998)). Another family, the inward rectifier potassium channels (Kir), belong to a structural family containing 2 transmembrane domains (see, e.g., Lagrutta et al.,
Jpn. Heart. J
. 37:651-660 1996)), and an eighth functionally diverse family (TP, or “two-pore”) contains 2 tandem repeats of this inward rectifier motif.
Potassium channels are typically formed by four alpha subunits, and can be homomeric (made of identical alpha subunits) or heteromeric (made of two or more distinct types of alpha subunits). In addition, potassium channels have often been found to contain additional, structurally distinct auxiliary, or beta, subunits (e.g., Kv, Slo, and KCNQ potassium channel families). These beta subunits do not form potassium channels themselves, but instead they act as auxiliary subunits to modify the functional properties of channels formed by alpha subunits. For example, the Kv beta subunits are cytoplasmic and are known to increase the surface expression of Kv channels and/or modify inactivation kinetics of the channel (Heinemann et al.,
J. Physiol
. 493:625-633 (1996); Shi et al.,
Neuron
16(4):843-852 (1996)). In another example, the KCNQ family beta subunit, minK, primarily changes activation kinetics (Sanguinetti et al.,
Nature
384:80-83 (1996)).
The Kv superfamily of voltage-gated potassium channels includes both heteromeric and homomeric channels that are typically composed of four subunits, as described above (see, e.g., Salinas et al.,
J. Biol. Chem
. 272:8774-8780 (1997); Salinas et al.,
J. Biol. Chem
. 272:24371-24379 (1997); Post et al.,
FEBS Letts
. 399:177-182 (1996)). Voltage-gated potassium channels have been found in a wide variety of tissues and cell types and are involved in processes such as neuronal integration, cardiac pacemaking, muscle contraction, hormone section, cell volume regulation, lymphocyte differentiation, and cell proliferation (see, e.g., Salinas et al.,
J. Biol. Chem
. 39:24371-24379 (1997)). Some alpha subunits of the Kv superfamily, of which the channels are composed, have been cloned and expressed, e.g., Kv2.1, Kv2.2, Kv5.1, Kv6.1 (Drewe et al.,
J. Neurosci
. 12:538-548 (1992); Post et al.,
FEBS Letts
. 399:177-182 (1996)); Kv8.1 (Hugnot et al.,
EMBO J
. 15:3322-3331 (1996)); and Kv9.1 and 9.2 (Salinas et al.,
J. Biol. Chem
. 39:24371-24379 (1997)). Expression patterns of some of these genes have also been examined (see, e.g., Verma-Kurvari et al.,
Mol. Brain. Res
. 46:54-62 (1997); Maletic-Savatic et al.,
J. Neurosci
. 15:3840-3851 (1995); Du et al.,
Neurosci
. 84:37-48 (1998)).
SUMMARY OF THE INVENTION
The present invention therefore provides, for the first time, a new member of the Kv superfamily and the Kv10 family of potassium channels. A novel human DNA sequence, Kv10.1, encoding a voltage-gated potassium channel of the Kv (or KCNA) gene family was cloned and is presented herein. Kv10.1 defines the previously unidentified subfamily of Kv10 potassium channels, as it does not clearly fit into any previously defined subfamilies. Kv10.1 is expressed in the brain (e.g., whole brain, substantia nigra, and frontal cortex), spinal cord, prostate, and retina. Modulators of Kv10.1 are useful in treating CNS disorders, such as epilepsy and other seizure disorders, Parkinson's disease, migraines, psychotic disorders such as schizophrenia and depression, cognitive disorders such as learning and memory disorders, neuropathic pain, vision disorders, prostate hyperplasia, for controlling spermatocyte maturation and motility, for treating infertility, and as contraceptive agents. Modulators are also useful as neuroprotective agents (e.g., to prevent stroke).
In one aspect, the present invention provides an isolated nucleic acid encoding a polypeptide comprising an alpha subunit of a Kv10 potassium channel, the polypeptide: (i) forming, with at least one additional Kv alpha subunit, a Kv potassium channel having the characteristic of voltage-gating; and (ii) comprising a subsequence having at least 60% amino acid sequence identity to amino acids 102 to 514 of SEQ ID NO:3.
In one embodiment, the nucleic acid comprises a nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:2. In another embodiment, the nucleic acid selectively hybridizes under moderately stringent hybridization conditions to a nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:2. In another embodiment, the nucleic acid is amplified by primers that selectively hybridize under stringent hybridization conditions to the same template sequence as the primers selected from the group consisting of:
GCCATGCTCAAACAGAGTGAGAGGAGAC (SEQ ID NO:4)
GAGCGTGAAGAAGCCCATGCACAG (SEQ ID NO:5)
GCAGCACCCCGGACAGGTAGAAA (SEQ ID NO:6)
CGGCCGGGTCGCGGTCGAAGAAGT (SEQ ID NO:7)
CCACCATGAGGGCAGCCAACACCGCAGGAGCA (SEQ NO:8)
GGCTGTCTACTCTGTGGAGCACGAT (SEQ ID NO:9)
GAGTATTTCTAGAGGCAGTACTTTGTG (SEQ ID NO:10) and
ATTCTCTTGTCTTGGGGTGAGCTG (SEQ ID NO:11)
In another aspect, the present invention provides an isolated nucleic acid encoding a Kv10 polypeptide, the nucleic acid specifically hybridizing under stringent conditions to a nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:2.
In another aspect, the present invention provides an isolated nucleic acid that specifically hybridizes under stringent conditions to a nucleic acid encoding an amino acid sequence of SEQ ID NO:3.
In another aspect, the present invention provides a method of detecting a nucleic acid, the method comprising contacting the nucleic acid with an isolated nucleic acid, as described above.
In another aspect, the present invention provides expression vectors comprising the nucleic acids of the invention, and host cells comprising such expression vectors.
In another aspect, the present invention provides an isolated polypeptide comprising an alpha subunit of a Kv10 potassium channel, the polypeptide: (i) forming, with at least one additional Kv alpha subunit, a Kv potassium channel having the characteristic of voltage-gating; and (ii) comprising a subsequence having at least 60% amino acid sequence identity to amino acids 102 to 514 of SEQ ID NO:3.
In one embodiment, the polypeptide specifically binds to antibodies generated against SEQ ID NO:3. In another embodiment, the polypeptide has a molecular weight of between about 58 kD to about 68 kD. In another embodiment, the polypeptide has an amino acid sequenc
Icagen Inc.
Mertz Prema
Townsend and Townsend / and Crew LLP
LandOfFree
Nucleic acid encoding Kv10.1, a voltage-gated potassium... does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Nucleic acid encoding Kv10.1, a voltage-gated potassium..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Nucleic acid encoding Kv10.1, a voltage-gated potassium... will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-3265656