Chemistry: molecular biology and microbiology – Vector – per se
Reexamination Certificate
1995-10-16
2002-02-12
Priebe, Scott D. (Department: 1632)
Chemistry: molecular biology and microbiology
Vector, per se
C435S325000, C435S455000, C435S458000, C435S462000, C435S463000, C514S04400A, C424S093200, C536S023100, C536S023200
Reexamination Certificate
active
06346414
ABSTRACT:
The present invention relates to a transposition assembly allowing the transfer of genes of interest into the genome of a cell or of a eukaryotic organism. Such an assembly is particularly useful for gene therapy purposes.
Numerous elements which can be employed by the integration of genes of interest into the eukaryotic genome have been described in the prior art publications. The conventional elements are either integrative vectors, for example retroviral vectors, or nonintegrative vectors, for example adenoviral vectors. However, these prior art vectors not only have advantages.
In fact, the retroviral vectors are integrated randomly into the cellular genome in a nonspecific manner. Thus the risk of insertional mutagenesis linked either to the inactivation of genes essential to the cell, or to the activation of oncogenes, which can give rise to a tumoral proliferation, is not to be neglected before contemplating their use in human gene therapy.
As far as the nonintegrative vectors are concerned, they have disadvantages linked to an instability on account of their nonintegration into the cellular genome, which necessitates their regularly repeated administration. Within the context of a gene therapy intended for man, in the long term this risks posing problems of immunization against the recombinant virus in regularly treated patients.
A third type of method, described more recently, allows the transfer of genes of interest by homologous recombination into a defined site of the cellular genome. However, the technique of homologous recombination again comes up against numerous technical difficulties. In addition, nonhomologous recombination events can equally be produced, so that the risk of insertional mutagenesis remains.
Moreover, the prior art has for a long time established the scheme of organization and of expression of ribosomal DNA (rDNA) in eukaryotes (Reeder, Trends Genet. 1990, 6, 390-395). Generally speaking, rDNA is formed by multiple copies of transcription units arranged in pairs. A transcriptional unit is composed of genes coding respectively for the 18S or 16S, 5-8S and 28S or 26S rRNAs, which enter into the constitution of the ribosome (below designated 18S rRNA gene etc.). Each gene is separated from the following by transcribed sequences whose exact role is still not defined. The three rRNA genes contained in a transcriptional unit are placed under the control of a unique promoter situated upstream in the nontranscribed region which separates one unit from the following. The units of rRNA are transcribed by the RNA polymerase I in a long molecule of precursor rRNA (pre-rRNA), which is then matured to produce the three principle types of rRNA associated to the ribosomal sub-units.
Numerous publications have reported the frequent presence of foreign genetic elements in the rDNA of eukaryotes. Among these genetic elements, introns of class I or II and retroposons, for example of class R1, R2 or R3, can be mentioned. The presence of these foreign elements can possibly inactivate a fraction of the transcriptional units of the rDNA. This does not seem to have serious consequences for the life of the organisms containing them. This phenomenon has particularly been described in the drosophila.
The introns of classes I and II are defined by the existence of preserved sequences forming structural elements characteristic of each of the classes such as defined by Cech and Bass (1986, Annu. Rev. Biochem 55, 599-629). Several authors have observed that certain introns of classes I and II are mobile. They can be copied and transferred specifically into copies of genes which are devoid of them (intron
−
). This transposition process, at least in the majority of cases, turns out to be specific from the point of view of the insertion region.
Among the sixty or so introns of class I characterized until now, the majority are localized in the genes of the mitochondria and of the chloroplasts. The prior art mentions, in three cases only, the presence of mobile introns of class I in the nuclear genes. These introns have been demonstrated at the level of the rRNA genes of three species of lower eukaryotes, respectively the 26S rRNA genes of several strains of Tetrahymena (Kan et Gall, 1982, Nucl. Acids Res., 10, 2809-2821) and of the Carolina strain of
Physarum polycephalum,
(Muscarella et Vogt, 1989, Cell, 56, 443-454; this mobile intron being designated intron 3 below) and finally in the 16S rRNA gene of
Pneumocystis carinii
(Edman et al., 1988, Nature 334, 519-522). Until now, it has not been possible to demonstrate the presence of introns interrupting the rRNA genes of higher eukaryotes.
The intron 3 of
Physarum polycephalum
is the best characterized. Its mobility has been demonstrated experimentally (Muscarella et Vogt, 1989, Cell, 56, 443-454). This intron codes in part for a protein of 160 amino acids (Muscarella et al., 1990, Mol. Cel. Biol., 10, 3386-3396). The initiation codon of the putative translation is situated upstream of the intron, at the 3′ end of the adjacent exon sequence at the 5′ end of the intron. The protein encoded by the intron 3 is an endonuclease which recognizes a target sequence of at least 18 base pairs (bp) present in the insertion region and is capable of cleaving this sequence exactly at the level of the site of insertion of the intron 3 (Muscarella et Vogt, 1989, Cell, 56, 443-454).
The target sequence recognized by the endonuclease comprises the following sequence: 5′ CTATGACTCTCTTAAGGTAGCCAAA3′ (SEQ ID NO:1). It is assumed that the transposition of the intron 3 is initiated by the recognition of the particular target sequence by the endonuclease specifically encoded by the intron 3, followed by a cutting of the two strands of the DNA molecule at the level of this particular sequence, thus liberating the insertion site. Then, by an exchange of fibers involving the flanking sequences at the 5′ and 3′ ends of the insertion site, copying of the intron sequence and recombination, the intron 3 is inserted into the copy of the intron
−
rRNA gene in a precise and site-specific manner. Once the intron 3 is inserted into a copy of the intron
−
gene, the target sequence recognized by the endonuclease is interrupted by the intron sequence in the following manner: 5′ CTATGACTCTCT (SEQ ID NO:2) intron 3 TAAGGTAGCCAAA3′ (SEQ ID NO:3).
On the other hand, retroposons equally seem to be present in the rDNA of certain eukaryotes. Generally speaking the retroposons form a very huge and very heterogeneous group, especially at the level of their nucleotide sequence. Retroposon is understood as meaning elements related to the retroviruses, but devoid of long terminal repeats (LTR). They comprise one or more open reading frames capable of coding for proteins having a homology with retroviral proteins, such as, for example, reverse transcriptase (Jakubczak et al., 1991, Proc. Natl. Acad. Sci. USA, 88, 3295-3299).
In a certain number of nonmammalian eukaryotes, especially insects, retroposons having a remarkable specificity of insertion have been found, localized at the level of the rRNA genes. The mobility of certain of these has been observed. Several families (especially R1, R2 and R3) have been defined as a function of their specific insertion region into the rRNA genes.
The retroposons of the classes R1 and R2 are especially illustrated by the retroposons R1Bm and R2Bm of
Bombyx mori
(Xiong and Eickbush, 1988, Cell, 55, 235-246; Xiong and Eickbush, 1988, Mol. Cell. Biol., 8, 114-123; Xiong et al., 1988, Nucl. Ac. Res., 16, 10561-10573) and the retroposons R1Dm and R2Dm of
Drosophila melanogaster
(Jakubczak et al., 1990, J. Mol. Biol., 212, 37-52). They contain air open reading frame capable of coding for a protein of great size whose central part has a homology with the reverse transcriptase family. Xiong and Eickbush (1988, Cell, 55, 235-246) report that the protein encoded by the retroposon R2Bm of Bombyx mori moreover has an endonuclease activity. This nuclease recognizes and cleave
Burns Doane Swecker & Mathis L.L.P.
Priebe Scott D.
Transgene S.A.
LandOfFree
Transposition assembly for gene transfer in eukaryotes does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Transposition assembly for gene transfer in eukaryotes, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Transposition assembly for gene transfer in eukaryotes will most certainly appreciate the feedback.
Profile ID: LFUS-PAI-O-2951770